FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634259_at:

>probe:Drosophila_2:1634259_at:495:331; Interrogation_Position=1022; Antisense; GCGGCTGGGCAGGATCCAGTTCAAA
>probe:Drosophila_2:1634259_at:179:361; Interrogation_Position=1060; Antisense; GCAATGTCCGTCGTTGGCCATCTGG
>probe:Drosophila_2:1634259_at:374:41; Interrogation_Position=1079; Antisense; ATCTGGTCGTCTAGTCTACTGTTCA
>probe:Drosophila_2:1634259_at:179:725; Interrogation_Position=1118; Antisense; TTGACATGTTCGCTCATCCATATTC
>probe:Drosophila_2:1634259_at:477:21; Interrogation_Position=1137; Antisense; ATATTCCACACATTCTCCCAAGATA
>probe:Drosophila_2:1634259_at:690:103; Interrogation_Position=603; Antisense; AGACTCCTCTGATCATGGTGGCAGC
>probe:Drosophila_2:1634259_at:459:435; Interrogation_Position=665; Antisense; GAGGAGGTCATGACACCCAGGTGAT
>probe:Drosophila_2:1634259_at:613:95; Interrogation_Position=711; Antisense; AGATTCACATGGCTCTTCCGGCGGA
>probe:Drosophila_2:1634259_at:105:629; Interrogation_Position=748; Antisense; TCCTCCGGTGGATACAGTGGTGGCT
>probe:Drosophila_2:1634259_at:338:459; Interrogation_Position=794; Antisense; GATATTCTGGTGGATCCTCTTACAG
>probe:Drosophila_2:1634259_at:666:335; Interrogation_Position=842; Antisense; GCTCGTCCTACAGCTCTGGAGGATA
>probe:Drosophila_2:1634259_at:35:333; Interrogation_Position=899; Antisense; GCGGCGGATCCAGCTATGATACACA
>probe:Drosophila_2:1634259_at:67:31; Interrogation_Position=917; Antisense; ATACACAAGTGGTGGCTGCAGCCGC
>probe:Drosophila_2:1634259_at:429:531; Interrogation_Position=985; Antisense; GGTGGCGACGGATACAGCTACTCAG

Paste this into a BLAST search page for me
GCGGCTGGGCAGGATCCAGTTCAAAGCAATGTCCGTCGTTGGCCATCTGGATCTGGTCGTCTAGTCTACTGTTCATTGACATGTTCGCTCATCCATATTCATATTCCACACATTCTCCCAAGATAAGACTCCTCTGATCATGGTGGCAGCGAGGAGGTCATGACACCCAGGTGATAGATTCACATGGCTCTTCCGGCGGATCCTCCGGTGGATACAGTGGTGGCTGATATTCTGGTGGATCCTCTTACAGGCTCGTCCTACAGCTCTGGAGGATAGCGGCGGATCCAGCTATGATACACAATACACAAGTGGTGGCTGCAGCCGCGGTGGCGACGGATACAGCTACTCAG

Full Affymetrix probeset data:

Annotations for 1634259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720