Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634261_at:

>probe:Drosophila_2:1634261_at:229:511; Interrogation_Position=1076; Antisense; GTGAACCCATCTCCATAGAGCAGGT
>probe:Drosophila_2:1634261_at:178:625; Interrogation_Position=1100; Antisense; TGCGCCAACTGGAGTTCCTGGAGGC
>probe:Drosophila_2:1634261_at:218:391; Interrogation_Position=1135; Antisense; GAAACTCTGCGGATGTATCCTTCAG
>probe:Drosophila_2:1634261_at:722:647; Interrogation_Position=1156; Antisense; TCAGGTCCACTCACTGCCAGAAAAG
>probe:Drosophila_2:1634261_at:479:667; Interrogation_Position=1249; Antisense; TACATGGGACGTTGCAAGGACTTCT
>probe:Drosophila_2:1634261_at:108:225; Interrogation_Position=1264; Antisense; AAGGACTTCTTTCCGGATCCGATGG
>probe:Drosophila_2:1634261_at:566:441; Interrogation_Position=1284; Antisense; GATGGTCTTCAAGCCAGATCGCTGG
>probe:Drosophila_2:1634261_at:180:125; Interrogation_Position=1322; Antisense; AGCCCAAAATTGAGGCCACCACTTT
>probe:Drosophila_2:1634261_at:703:121; Interrogation_Position=1385; Antisense; AGCGGTATGCGATGGTCATGCTCAA
>probe:Drosophila_2:1634261_at:244:185; Interrogation_Position=1408; Antisense; AAAATGGTGCTAGCTCACCTGCTGA
>probe:Drosophila_2:1634261_at:351:129; Interrogation_Position=1424; Antisense; ACCTGCTGAGGAACTTCCTGTTCGA
>probe:Drosophila_2:1634261_at:127:123; Interrogation_Position=1448; Antisense; AGCCCCTTGGCGAGCGACAGGTGAA
>probe:Drosophila_2:1634261_at:84:193; Interrogation_Position=1483; Antisense; AACTTTGTGATCACGCTGCATACCG
>probe:Drosophila_2:1634261_at:693:617; Interrogation_Position=1499; Antisense; TGCATACCGTTGAACCCTATCTATG

Paste this into a BLAST search page for me
GTGAACCCATCTCCATAGAGCAGGTTGCGCCAACTGGAGTTCCTGGAGGCGAAACTCTGCGGATGTATCCTTCAGTCAGGTCCACTCACTGCCAGAAAAGTACATGGGACGTTGCAAGGACTTCTAAGGACTTCTTTCCGGATCCGATGGGATGGTCTTCAAGCCAGATCGCTGGAGCCCAAAATTGAGGCCACCACTTTAGCGGTATGCGATGGTCATGCTCAAAAAATGGTGCTAGCTCACCTGCTGAACCTGCTGAGGAACTTCCTGTTCGAAGCCCCTTGGCGAGCGACAGGTGAAAACTTTGTGATCACGCTGCATACCGTGCATACCGTTGAACCCTATCTATG

Full Affymetrix probeset data:

Annotations for 1634261_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime