FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634263_at:

>probe:Drosophila_2:1634263_at:63:135; Interrogation_Position=200; Antisense; ACCCACATAAGGAATTGCTCGGCGA
>probe:Drosophila_2:1634263_at:444:587; Interrogation_Position=332; Antisense; TGGAGTATCTGGACGCAGCCTTGCA
>probe:Drosophila_2:1634263_at:167:249; Interrogation_Position=362; Antisense; CAATAAATTCCCTGCAATGCTCGCT
>probe:Drosophila_2:1634263_at:289:527; Interrogation_Position=412; Antisense; GGGAAACCACATCCGGAATTCCAGA
>probe:Drosophila_2:1634263_at:422:435; Interrogation_Position=447; Antisense; GAGGTATTTCTACATCGAGCGGCAT
>probe:Drosophila_2:1634263_at:448:43; Interrogation_Position=460; Antisense; ATCGAGCGGCATGTCAGGCAGAATT
>probe:Drosophila_2:1634263_at:477:447; Interrogation_Position=490; Antisense; GATGCCGCTGACAAATGCCGTAGGA
>probe:Drosophila_2:1634263_at:585:581; Interrogation_Position=527; Antisense; TGGCGACGCCCCAAGACGAGGATGA
>probe:Drosophila_2:1634263_at:672:489; Interrogation_Position=555; Antisense; GTACTTAATCCGCAAGCAGCTTGAA
>probe:Drosophila_2:1634263_at:566:1; Interrogation_Position=631; Antisense; ATATCCCTGGCCACCGGAAAAGAAG
>probe:Drosophila_2:1634263_at:180:697; Interrogation_Position=656; Antisense; TTTCGTATCTCAAGTGGCGACACGG
>probe:Drosophila_2:1634263_at:357:591; Interrogation_Position=709; Antisense; TGTGCTTATTTATACGCCGGAGACT
>probe:Drosophila_2:1634263_at:21:319; Interrogation_Position=724; Antisense; GCCGGAGACTATTACACATACCAGT
>probe:Drosophila_2:1634263_at:714:147; Interrogation_Position=761; Antisense; ACTTTTTCATTTGCCAAGCTGTGTA

Paste this into a BLAST search page for me
ACCCACATAAGGAATTGCTCGGCGATGGAGTATCTGGACGCAGCCTTGCACAATAAATTCCCTGCAATGCTCGCTGGGAAACCACATCCGGAATTCCAGAGAGGTATTTCTACATCGAGCGGCATATCGAGCGGCATGTCAGGCAGAATTGATGCCGCTGACAAATGCCGTAGGATGGCGACGCCCCAAGACGAGGATGAGTACTTAATCCGCAAGCAGCTTGAAATATCCCTGGCCACCGGAAAAGAAGTTTCGTATCTCAAGTGGCGACACGGTGTGCTTATTTATACGCCGGAGACTGCCGGAGACTATTACACATACCAGTACTTTTTCATTTGCCAAGCTGTGTA

Full Affymetrix probeset data:

Annotations for 1634263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720