FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634264_at:

>probe:Drosophila_2:1634264_at:436:423; Interrogation_Position=107; Antisense; GAGAACTCTATGAACTGCGCAACGA
>probe:Drosophila_2:1634264_at:642:383; Interrogation_Position=118; Antisense; GAACTGCGCAACGATGCCAAACTTA
>probe:Drosophila_2:1634264_at:103:137; Interrogation_Position=128; Antisense; ACGATGCCAAACTTAGGGCTGTTTA
>probe:Drosophila_2:1634264_at:143:525; Interrogation_Position=143; Antisense; GGGCTGTTTATAGCACTCAGAACTA
>probe:Drosophila_2:1634264_at:283:191; Interrogation_Position=181; Antisense; AACATAGTGGATGCGGCTCATCTTC
>probe:Drosophila_2:1634264_at:347:647; Interrogation_Position=198; Antisense; TCATCTTCGTCCAGTGACCAAGGGC
>probe:Drosophila_2:1634264_at:33:411; Interrogation_Position=213; Antisense; GACCAAGGGCGACAAGGCGAATTTT
>probe:Drosophila_2:1634264_at:311:367; Interrogation_Position=246; Antisense; GAATCGACTATGGAACTCGGCGGCC
>probe:Drosophila_2:1634264_at:124:321; Interrogation_Position=268; Antisense; GCCCGGGATTAATTTGTTAATTGCG
>probe:Drosophila_2:1634264_at:216:671; Interrogation_Position=27; Antisense; TACCGACATGGATAACTGGAAGATA
>probe:Drosophila_2:1634264_at:709:651; Interrogation_Position=50; Antisense; TAACCGCGGAGGAGCTTATCCGTCT
>probe:Drosophila_2:1634264_at:177:47; Interrogation_Position=67; Antisense; ATCCGTCTGCGGGAGAGCTGCTTGC
>probe:Drosophila_2:1634264_at:156:419; Interrogation_Position=81; Antisense; GAGCTGCTTGCAGTGCATCCGTGAT
>probe:Drosophila_2:1634264_at:549:509; Interrogation_Position=93; Antisense; GTGCATCCGTGATGGAGAACTCTAT

Paste this into a BLAST search page for me
GAGAACTCTATGAACTGCGCAACGAGAACTGCGCAACGATGCCAAACTTAACGATGCCAAACTTAGGGCTGTTTAGGGCTGTTTATAGCACTCAGAACTAAACATAGTGGATGCGGCTCATCTTCTCATCTTCGTCCAGTGACCAAGGGCGACCAAGGGCGACAAGGCGAATTTTGAATCGACTATGGAACTCGGCGGCCGCCCGGGATTAATTTGTTAATTGCGTACCGACATGGATAACTGGAAGATATAACCGCGGAGGAGCTTATCCGTCTATCCGTCTGCGGGAGAGCTGCTTGCGAGCTGCTTGCAGTGCATCCGTGATGTGCATCCGTGATGGAGAACTCTAT

Full Affymetrix probeset data:

Annotations for 1634264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720