Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634265_at:

>probe:Drosophila_2:1634265_at:174:725; Interrogation_Position=382; Antisense; TTGGTTGTAGCTCTATCCCTTAACA
>probe:Drosophila_2:1634265_at:156:649; Interrogation_Position=409; Antisense; TCAGCTGCAGTGTTGAACCCTAGTT
>probe:Drosophila_2:1634265_at:93:679; Interrogation_Position=429; Antisense; TAGTTCGACTGCCAAACCCAGATTT
>probe:Drosophila_2:1634265_at:638:181; Interrogation_Position=468; Antisense; AAAACTAAGTGCTGGCGCTCTGCAG
>probe:Drosophila_2:1634265_at:726:347; Interrogation_Position=489; Antisense; GCAGTCACTCGCTGGTTAATTACTA
>probe:Drosophila_2:1634265_at:234:645; Interrogation_Position=584; Antisense; TAAGTTTCTTTCGTTTGGGATACAG
>probe:Drosophila_2:1634265_at:415:399; Interrogation_Position=654; Antisense; GACACTACAAGCTAGGGAACCCGGG
>probe:Drosophila_2:1634265_at:664:363; Interrogation_Position=670; Antisense; GAACCCGGGCGGAACCAGCTGTATT
>probe:Drosophila_2:1634265_at:174:481; Interrogation_Position=690; Antisense; GTATTTAGCATTAGCCCTAAGCTCT
>probe:Drosophila_2:1634265_at:194:505; Interrogation_Position=737; Antisense; GGCCGGGAACTTGAACAGGTGCTTT
>probe:Drosophila_2:1634265_at:89:533; Interrogation_Position=754; Antisense; GGTGCTTTCCAGTGGCCTGAACGGA
>probe:Drosophila_2:1634265_at:349:431; Interrogation_Position=785; Antisense; GAGTCCCGCGTTCGGAATGATGTTC
>probe:Drosophila_2:1634265_at:304:27; Interrogation_Position=820; Antisense; ATAGCGATACGTTGCGGTTGTCCTT
>probe:Drosophila_2:1634265_at:45:1; Interrogation_Position=853; Antisense; TCCCGTCGTCCCAGAAGTAGTACTT

Paste this into a BLAST search page for me
TTGGTTGTAGCTCTATCCCTTAACATCAGCTGCAGTGTTGAACCCTAGTTTAGTTCGACTGCCAAACCCAGATTTAAAACTAAGTGCTGGCGCTCTGCAGGCAGTCACTCGCTGGTTAATTACTATAAGTTTCTTTCGTTTGGGATACAGGACACTACAAGCTAGGGAACCCGGGGAACCCGGGCGGAACCAGCTGTATTGTATTTAGCATTAGCCCTAAGCTCTGGCCGGGAACTTGAACAGGTGCTTTGGTGCTTTCCAGTGGCCTGAACGGAGAGTCCCGCGTTCGGAATGATGTTCATAGCGATACGTTGCGGTTGTCCTTTCCCGTCGTCCCAGAAGTAGTACTT

Full Affymetrix probeset data:

Annotations for 1634265_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime