FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634267_at:

>probe:Drosophila_2:1634267_at:64:333; Interrogation_Position=320; Antisense; GCTGGTGTGTTTTGGGAACCGCATA
>probe:Drosophila_2:1634267_at:263:529; Interrogation_Position=358; Antisense; GGGATTCGAAATGCACCTGGGTGTA
>probe:Drosophila_2:1634267_at:168:601; Interrogation_Position=379; Antisense; TGTAAACCACATCGGACACTTCCTG
>probe:Drosophila_2:1634267_at:104:653; Interrogation_Position=507; Antisense; TCAACAGCTCTGATTTTTACGACGA
>probe:Drosophila_2:1634267_at:502:529; Interrogation_Position=532; Antisense; GGGAGTAGCCTACTGCCAAAGTAAG
>probe:Drosophila_2:1634267_at:224:493; Interrogation_Position=552; Antisense; GTAAGCTGGCCAACATACTCTTCAC
>probe:Drosophila_2:1634267_at:572:493; Interrogation_Position=617; Antisense; GTCAACGCCCTTAATCCTGGAATAG
>probe:Drosophila_2:1634267_at:574:457; Interrogation_Position=652; Antisense; GATAGCCAGGAACATGATCTTCTTC
>probe:Drosophila_2:1634267_at:328:175; Interrogation_Position=693; Antisense; AAACCATTTTGAGGCCGCTCCTTTG
>probe:Drosophila_2:1634267_at:428:277; Interrogation_Position=713; Antisense; CTTTGGGCCGTGATGAAGACGCCTA
>probe:Drosophila_2:1634267_at:582:103; Interrogation_Position=750; Antisense; AGACCACCTTGTATGCTGCCTTGGA
>probe:Drosophila_2:1634267_at:542:335; Interrogation_Position=764; Antisense; GCTGCCTTGGATCCTGATCTCGAAA
>probe:Drosophila_2:1634267_at:609:531; Interrogation_Position=796; Antisense; GGGTCAGTACTTCAGCGATTGCGCT
>probe:Drosophila_2:1634267_at:374:635; Interrogation_Position=846; Antisense; TCGACGACCAGATGGCCCAGTGGTT

Paste this into a BLAST search page for me
GCTGGTGTGTTTTGGGAACCGCATAGGGATTCGAAATGCACCTGGGTGTATGTAAACCACATCGGACACTTCCTGTCAACAGCTCTGATTTTTACGACGAGGGAGTAGCCTACTGCCAAAGTAAGGTAAGCTGGCCAACATACTCTTCACGTCAACGCCCTTAATCCTGGAATAGGATAGCCAGGAACATGATCTTCTTCAAACCATTTTGAGGCCGCTCCTTTGCTTTGGGCCGTGATGAAGACGCCTAAGACCACCTTGTATGCTGCCTTGGAGCTGCCTTGGATCCTGATCTCGAAAGGGTCAGTACTTCAGCGATTGCGCTTCGACGACCAGATGGCCCAGTGGTT

Full Affymetrix probeset data:

Annotations for 1634267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720