Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634269_at:

>probe:Drosophila_2:1634269_at:624:643; Interrogation_Position=2965; Antisense; TCATAAAGCTGTTCAATTTGTTGTT
>probe:Drosophila_2:1634269_at:609:169; Interrogation_Position=3026; Antisense; AAAGGCAGACCTAGTTTATACACAC
>probe:Drosophila_2:1634269_at:625:149; Interrogation_Position=3075; Antisense; ACTTCTTATGTGAGATGCAGCTACA
>probe:Drosophila_2:1634269_at:556:221; Interrogation_Position=3181; Antisense; AAGGGACCAAGCCAGAGTTGACACA
>probe:Drosophila_2:1634269_at:173:469; Interrogation_Position=3197; Antisense; GTTGACACAGCCTTCAAGTTTTCCA
>probe:Drosophila_2:1634269_at:511:215; Interrogation_Position=3212; Antisense; AAGTTTTCCAAAATCCACGCAGAGA
>probe:Drosophila_2:1634269_at:144:49; Interrogation_Position=3224; Antisense; ATCCACGCAGAGACATATCCACATT
>probe:Drosophila_2:1634269_at:578:257; Interrogation_Position=3243; Antisense; CACATTGTGCAAATTTCTCGCCAAG
>probe:Drosophila_2:1634269_at:406:711; Interrogation_Position=3257; Antisense; TTCTCGCCAAGAAAACTTCCCTCAG
>probe:Drosophila_2:1634269_at:712:179; Interrogation_Position=3268; Antisense; AAAACTTCCCTCAGCTCGGGCCTTG
>probe:Drosophila_2:1634269_at:248:639; Interrogation_Position=3283; Antisense; TCGGGCCTTGAACCTTGTTTAGATT
>probe:Drosophila_2:1634269_at:282:497; Interrogation_Position=3322; Antisense; GTCATTGTTTTTCGTACGTCGTTAG
>probe:Drosophila_2:1634269_at:44:501; Interrogation_Position=3346; Antisense; GTCGAATTAATTTTGTAGCCCTGTA
>probe:Drosophila_2:1634269_at:356:487; Interrogation_Position=3360; Antisense; GTAGCCCTGTAAGTTCAATTTGTAT

Paste this into a BLAST search page for me
TCATAAAGCTGTTCAATTTGTTGTTAAAGGCAGACCTAGTTTATACACACACTTCTTATGTGAGATGCAGCTACAAAGGGACCAAGCCAGAGTTGACACAGTTGACACAGCCTTCAAGTTTTCCAAAGTTTTCCAAAATCCACGCAGAGAATCCACGCAGAGACATATCCACATTCACATTGTGCAAATTTCTCGCCAAGTTCTCGCCAAGAAAACTTCCCTCAGAAAACTTCCCTCAGCTCGGGCCTTGTCGGGCCTTGAACCTTGTTTAGATTGTCATTGTTTTTCGTACGTCGTTAGGTCGAATTAATTTTGTAGCCCTGTAGTAGCCCTGTAAGTTCAATTTGTAT

Full Affymetrix probeset data:

Annotations for 1634269_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime