FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634270_at:

>probe:Drosophila_2:1634270_at:492:691; Interrogation_Position=1005; Antisense; TATTGTCGGACTTTCAGCCATGGCA
>probe:Drosophila_2:1634270_at:395:67; Interrogation_Position=1024; Antisense; ATGGCACCCGTACTGGACGTCACGA
>probe:Drosophila_2:1634270_at:467:485; Interrogation_Position=1042; Antisense; GTCACGAACTACTGGTTTGCCTTGG
>probe:Drosophila_2:1634270_at:597:729; Interrogation_Position=1063; Antisense; TTGGAAACACTACCTCTGAACGCGT
>probe:Drosophila_2:1634270_at:151:379; Interrogation_Position=1143; Antisense; GAAGCTGTTCCGATTTTCACTGATA
>probe:Drosophila_2:1634270_at:698:305; Interrogation_Position=1179; Antisense; CCTGATGCTGCTATTTCTGACCAAT
>probe:Drosophila_2:1634270_at:195:215; Interrogation_Position=1211; Antisense; AATGGTATTTCAGCAAACCCGCCGG
>probe:Drosophila_2:1634270_at:633:169; Interrogation_Position=1248; Antisense; AAAGGAGTCCACGTACAGTGCGATA
>probe:Drosophila_2:1634270_at:284:283; Interrogation_Position=1280; Antisense; CTGCTAGCAGTCTTGGTAATGTCCT
>probe:Drosophila_2:1634270_at:648:317; Interrogation_Position=1312; Antisense; GCCGTAGCCGAAGGACCCAGATAGA
>probe:Drosophila_2:1634270_at:165:657; Interrogation_Position=1429; Antisense; TAAGGAAACACGTACCCCTGTGCGG
>probe:Drosophila_2:1634270_at:405:541; Interrogation_Position=921; Antisense; GGATTATTCACGTGCCGGCTACCGA
>probe:Drosophila_2:1634270_at:137:231; Interrogation_Position=945; Antisense; AATGATGGCCGTTACCAATCCGGGT
>probe:Drosophila_2:1634270_at:460:459; Interrogation_Position=992; Antisense; GATATTCGGTGGCTATTGTCGGACT

Paste this into a BLAST search page for me
TATTGTCGGACTTTCAGCCATGGCAATGGCACCCGTACTGGACGTCACGAGTCACGAACTACTGGTTTGCCTTGGTTGGAAACACTACCTCTGAACGCGTGAAGCTGTTCCGATTTTCACTGATACCTGATGCTGCTATTTCTGACCAATAATGGTATTTCAGCAAACCCGCCGGAAAGGAGTCCACGTACAGTGCGATACTGCTAGCAGTCTTGGTAATGTCCTGCCGTAGCCGAAGGACCCAGATAGATAAGGAAACACGTACCCCTGTGCGGGGATTATTCACGTGCCGGCTACCGAAATGATGGCCGTTACCAATCCGGGTGATATTCGGTGGCTATTGTCGGACT

Full Affymetrix probeset data:

Annotations for 1634270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720