Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634271_at:

>probe:Drosophila_2:1634271_at:700:597; Interrogation_Position=111; Antisense; TGTCCTGGTGCATGAGGATGCCCAC
>probe:Drosophila_2:1634271_at:637:49; Interrogation_Position=128; Antisense; ATGCCCACCAGGAGGTGCTGCAGCA
>probe:Drosophila_2:1634271_at:139:53; Interrogation_Position=13; Antisense; ATGAAGTTCTTCGTTCTCGTGGCTA
>probe:Drosophila_2:1634271_at:208:109; Interrogation_Position=161; Antisense; AGAAGCGAGCCACATGCGACCTACT
>probe:Drosophila_2:1634271_at:437:39; Interrogation_Position=174; Antisense; ATGCGACCTACTCTCCAAGTGGAAC
>probe:Drosophila_2:1634271_at:110:625; Interrogation_Position=214; Antisense; TGCGCCGGCCACTGCATTGCCAAGG
>probe:Drosophila_2:1634271_at:64:403; Interrogation_Position=240; Antisense; GTTCAAAGGCGGCTACTGCAACGAC
>probe:Drosophila_2:1634271_at:574:339; Interrogation_Position=251; Antisense; GCTACTGCAACGACAAGGCCGTCTG
>probe:Drosophila_2:1634271_at:491:225; Interrogation_Position=265; Antisense; AAGGCCGTCTGCGTTTGCCGCAATT
>probe:Drosophila_2:1634271_at:531:639; Interrogation_Position=29; Antisense; TCGTGGCTATCGCTTTTGCTCTGCT
>probe:Drosophila_2:1634271_at:92:723; Interrogation_Position=44; Antisense; TTGCTCTGCTTGCTTGCGTGGCGCA
>probe:Drosophila_2:1634271_at:114:349; Interrogation_Position=66; Antisense; GCAGGCTCAGCCAGTTTCCGATGTG
>probe:Drosophila_2:1634271_at:649:479; Interrogation_Position=79; Antisense; GTTTCCGATGTGGATCCAATTCCAG
>probe:Drosophila_2:1634271_at:348:9; Interrogation_Position=97; Antisense; ATTCCAGAGGATCATGTCCTGGTGC

Paste this into a BLAST search page for me
TGTCCTGGTGCATGAGGATGCCCACATGCCCACCAGGAGGTGCTGCAGCAATGAAGTTCTTCGTTCTCGTGGCTAAGAAGCGAGCCACATGCGACCTACTATGCGACCTACTCTCCAAGTGGAACTGCGCCGGCCACTGCATTGCCAAGGGTTCAAAGGCGGCTACTGCAACGACGCTACTGCAACGACAAGGCCGTCTGAAGGCCGTCTGCGTTTGCCGCAATTTCGTGGCTATCGCTTTTGCTCTGCTTTGCTCTGCTTGCTTGCGTGGCGCAGCAGGCTCAGCCAGTTTCCGATGTGGTTTCCGATGTGGATCCAATTCCAGATTCCAGAGGATCATGTCCTGGTGC

Full Affymetrix probeset data:

Annotations for 1634271_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime