FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634272_at:

>probe:Drosophila_2:1634272_at:35:585; Interrogation_Position=3206; Antisense; TGGAAGCGGCCAATGCCCAGTTGAT
>probe:Drosophila_2:1634272_at:402:455; Interrogation_Position=3237; Antisense; GATAGCCTCGGATCACTACAAGACC
>probe:Drosophila_2:1634272_at:554:411; Interrogation_Position=3258; Antisense; GACCGGCGACATGCAGAACTACCAT
>probe:Drosophila_2:1634272_at:33:385; Interrogation_Position=3273; Antisense; GAACTACCATGTGCTGGGACTTGCC
>probe:Drosophila_2:1634272_at:282:403; Interrogation_Position=3290; Antisense; GACTTGCCCTTTCCGAGGTGGAGAT
>probe:Drosophila_2:1634272_at:453:427; Interrogation_Position=3310; Antisense; GAGATCGATGTGCTGACCGGCAACA
>probe:Drosophila_2:1634272_at:50:611; Interrogation_Position=3323; Antisense; TGACCGGCAACATTCTGATCAGGCG
>probe:Drosophila_2:1634272_at:718:593; Interrogation_Position=3431; Antisense; TGGGCTACTGGCTCAGCGAACTGCT
>probe:Drosophila_2:1634272_at:608:383; Interrogation_Position=3448; Antisense; GAACTGCTCATCTACGAGGGCGACA
>probe:Drosophila_2:1634272_at:232:11; Interrogation_Position=3529; Antisense; ATTCCCATTGATTTCCGCGTGGAAC
>probe:Drosophila_2:1634272_at:309:89; Interrogation_Position=3574; Antisense; AGTAGTTCGGGTTTCATGGGCTCAA
>probe:Drosophila_2:1634272_at:240:461; Interrogation_Position=3639; Antisense; GATTTTTGCACTTCAACAGGCTCTG
>probe:Drosophila_2:1634272_at:51:425; Interrogation_Position=3730; Antisense; GAGACTCTGCTACTAAATGCCGGAC
>probe:Drosophila_2:1634272_at:599:233; Interrogation_Position=3745; Antisense; AATGCCGGACACCAAGTCTCGGAGT

Paste this into a BLAST search page for me
TGGAAGCGGCCAATGCCCAGTTGATGATAGCCTCGGATCACTACAAGACCGACCGGCGACATGCAGAACTACCATGAACTACCATGTGCTGGGACTTGCCGACTTGCCCTTTCCGAGGTGGAGATGAGATCGATGTGCTGACCGGCAACATGACCGGCAACATTCTGATCAGGCGTGGGCTACTGGCTCAGCGAACTGCTGAACTGCTCATCTACGAGGGCGACAATTCCCATTGATTTCCGCGTGGAACAGTAGTTCGGGTTTCATGGGCTCAAGATTTTTGCACTTCAACAGGCTCTGGAGACTCTGCTACTAAATGCCGGACAATGCCGGACACCAAGTCTCGGAGT

Full Affymetrix probeset data:

Annotations for 1634272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720