Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634274_s_at:

>probe:Drosophila_2:1634274_s_at:314:449; Interrogation_Position=1012; Antisense; GATCCTTAACTGTGCATGGCTGCGA
>probe:Drosophila_2:1634274_s_at:369:609; Interrogation_Position=1032; Antisense; TGCGAACCGTCGAGGAATCCCAAAC
>probe:Drosophila_2:1634274_s_at:307:359; Interrogation_Position=1086; Antisense; GCAAAATCTCTGAAGCCACTCATCA
>probe:Drosophila_2:1634274_s_at:202:369; Interrogation_Position=1115; Antisense; GAATCCTATGAGCACTTGCACGCAT
>probe:Drosophila_2:1634274_s_at:35:347; Interrogation_Position=1136; Antisense; GCATAGCGCGTTGGTTTCACAGATA
>probe:Drosophila_2:1634274_s_at:76:403; Interrogation_Position=730; Antisense; GACATACTGCGGATCAGCTGCTTAT
>probe:Drosophila_2:1634274_s_at:248:119; Interrogation_Position=745; Antisense; AGCTGCTTATGCTGCACCTGAAGTA
>probe:Drosophila_2:1634274_s_at:355:503; Interrogation_Position=811; Antisense; GTCCTTGGGAGTCATTCTGTTCATC
>probe:Drosophila_2:1634274_s_at:161:369; Interrogation_Position=841; Antisense; GAATGCCAAGATGCCTTTCGATGAC
>probe:Drosophila_2:1634274_s_at:269:115; Interrogation_Position=894; Antisense; AGCGTAACCGCAAGTTTGCCTTTCG
>probe:Drosophila_2:1634274_s_at:209:627; Interrogation_Position=910; Antisense; TGCCTTTCGCCGGAAGCTGCAGGAA
>probe:Drosophila_2:1634274_s_at:247:73; Interrogation_Position=930; Antisense; AGGAAACGATATCGGCCCAGGCGAA
>probe:Drosophila_2:1634274_s_at:343:713; Interrogation_Position=964; Antisense; TTCAGTGCTGCTCGAACCGGAGGCA
>probe:Drosophila_2:1634274_s_at:38:549; Interrogation_Position=982; Antisense; GGAGGCACATGCTCGCTGGAATCTA

Paste this into a BLAST search page for me
GATCCTTAACTGTGCATGGCTGCGATGCGAACCGTCGAGGAATCCCAAACGCAAAATCTCTGAAGCCACTCATCAGAATCCTATGAGCACTTGCACGCATGCATAGCGCGTTGGTTTCACAGATAGACATACTGCGGATCAGCTGCTTATAGCTGCTTATGCTGCACCTGAAGTAGTCCTTGGGAGTCATTCTGTTCATCGAATGCCAAGATGCCTTTCGATGACAGCGTAACCGCAAGTTTGCCTTTCGTGCCTTTCGCCGGAAGCTGCAGGAAAGGAAACGATATCGGCCCAGGCGAATTCAGTGCTGCTCGAACCGGAGGCAGGAGGCACATGCTCGCTGGAATCTA

Full Affymetrix probeset data:

Annotations for 1634274_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime