FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634277_at:

>probe:Drosophila_2:1634277_at:71:355; Interrogation_Position=1139; Antisense; GCACCTTGTGCGACCGAAGTTTTGT
>probe:Drosophila_2:1634277_at:80:409; Interrogation_Position=1166; Antisense; GACGTTGCGAGCTGGCTAATCACAT
>probe:Drosophila_2:1634277_at:687:29; Interrogation_Position=1189; Antisense; ATACAGCGGGTCCATATCGGCAAGA
>probe:Drosophila_2:1634277_at:104:221; Interrogation_Position=1219; Antisense; AAGTGCACCCATTGTGAGCGTTCAT
>probe:Drosophila_2:1634277_at:656:327; Interrogation_Position=1236; Antisense; GCGTTCATTCGCTGTGATGTCGGAC
>probe:Drosophila_2:1634277_at:554:705; Interrogation_Position=1299; Antisense; TTACGTCTGCGAGCATTGCGGCAAG
>probe:Drosophila_2:1634277_at:327:493; Interrogation_Position=1357; Antisense; GTCACGGCTATTCACACGAAGATCA
>probe:Drosophila_2:1634277_at:218:103; Interrogation_Position=1381; Antisense; AGAGCCTTCAAGTGCACCATGTGTC
>probe:Drosophila_2:1634277_at:638:639; Interrogation_Position=1435; Antisense; TCGGATCACATCAAGGGCCATTTAA
>probe:Drosophila_2:1634277_at:633:521; Interrogation_Position=1449; Antisense; GGGCCATTTAAACATCCGCGACAAA
>probe:Drosophila_2:1634277_at:9:659; Interrogation_Position=1491; Antisense; TAAGGGATTCACCAGCTGCCATGCA
>probe:Drosophila_2:1634277_at:19:729; Interrogation_Position=1556; Antisense; TTGTGTGCAAACTCTGCGACTCCAG
>probe:Drosophila_2:1634277_at:657:469; Interrogation_Position=1581; Antisense; GTTCTCCCAGTTTGTGGGTCTTAAT
>probe:Drosophila_2:1634277_at:370:353; Interrogation_Position=1619; Antisense; GCACCCACAACATTCTTCGTAATAA

Paste this into a BLAST search page for me
GCACCTTGTGCGACCGAAGTTTTGTGACGTTGCGAGCTGGCTAATCACATATACAGCGGGTCCATATCGGCAAGAAAGTGCACCCATTGTGAGCGTTCATGCGTTCATTCGCTGTGATGTCGGACTTACGTCTGCGAGCATTGCGGCAAGGTCACGGCTATTCACACGAAGATCAAGAGCCTTCAAGTGCACCATGTGTCTCGGATCACATCAAGGGCCATTTAAGGGCCATTTAAACATCCGCGACAAATAAGGGATTCACCAGCTGCCATGCATTGTGTGCAAACTCTGCGACTCCAGGTTCTCCCAGTTTGTGGGTCTTAATGCACCCACAACATTCTTCGTAATAA

Full Affymetrix probeset data:

Annotations for 1634277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720