FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634278_at:

>probe:Drosophila_2:1634278_at:634:299; Interrogation_Position=1042; Antisense; CCCGTGGCCGAGCTCTTCGAGAAGA
>probe:Drosophila_2:1634278_at:515:31; Interrogation_Position=1079; Antisense; ATAAGTCCACTTCCAGTTCCGAGGA
>probe:Drosophila_2:1634278_at:700:391; Interrogation_Position=1113; Antisense; GAAAGCTAAGGCCTAGGCTTCCTAT
>probe:Drosophila_2:1634278_at:337:571; Interrogation_Position=1128; Antisense; GGCTTCCTATGTTAAGAGTCGCTAA
>probe:Drosophila_2:1634278_at:213:503; Interrogation_Position=1145; Antisense; GTCGCTAATGGGACCATCACGAGAT
>probe:Drosophila_2:1634278_at:13:35; Interrogation_Position=1160; Antisense; ATCACGAGATTTGTAGTCAGCGAAA
>probe:Drosophila_2:1634278_at:81:651; Interrogation_Position=666; Antisense; TCACCACGAGGAGGGCCACAAGGAT
>probe:Drosophila_2:1634278_at:528:81; Interrogation_Position=710; Antisense; AGGTGGAGGATCTTTCGCTGCCCCA
>probe:Drosophila_2:1634278_at:705:173; Interrogation_Position=783; Antisense; AAAGCGCGAGACTGTGGAGAAACCC
>probe:Drosophila_2:1634278_at:622:173; Interrogation_Position=802; Antisense; AAACCCGACAGCGTGAAGGCCCGTG
>probe:Drosophila_2:1634278_at:601:75; Interrogation_Position=857; Antisense; AGGAGCTCCACAAGGCCATCGAATC
>probe:Drosophila_2:1634278_at:12:271; Interrogation_Position=873; Antisense; CATCGAATCTCTGGCCGGTGGAAAG
>probe:Drosophila_2:1634278_at:463:561; Interrogation_Position=903; Antisense; GGAACAGCGTCACCAGCGCGATATT
>probe:Drosophila_2:1634278_at:398:165; Interrogation_Position=982; Antisense; AAATCGGAGCTGGAAAGCACCACTC

Paste this into a BLAST search page for me
CCCGTGGCCGAGCTCTTCGAGAAGAATAAGTCCACTTCCAGTTCCGAGGAGAAAGCTAAGGCCTAGGCTTCCTATGGCTTCCTATGTTAAGAGTCGCTAAGTCGCTAATGGGACCATCACGAGATATCACGAGATTTGTAGTCAGCGAAATCACCACGAGGAGGGCCACAAGGATAGGTGGAGGATCTTTCGCTGCCCCAAAAGCGCGAGACTGTGGAGAAACCCAAACCCGACAGCGTGAAGGCCCGTGAGGAGCTCCACAAGGCCATCGAATCCATCGAATCTCTGGCCGGTGGAAAGGGAACAGCGTCACCAGCGCGATATTAAATCGGAGCTGGAAAGCACCACTC

Full Affymetrix probeset data:

Annotations for 1634278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720