Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634279_at:

>probe:Drosophila_2:1634279_at:1:337; Interrogation_Position=320; Antisense; GCTCCAACAAGTTCATCGTGCACGA
>probe:Drosophila_2:1634279_at:602:509; Interrogation_Position=337; Antisense; GTGCACGAACGTTTCAATCCGGAGA
>probe:Drosophila_2:1634279_at:23:105; Interrogation_Position=359; Antisense; AGACGGCGGCCAATGATATTGCGCT
>probe:Drosophila_2:1634279_at:302:21; Interrogation_Position=374; Antisense; ATATTGCGCTGGTCAAGCTGCCGCA
>probe:Drosophila_2:1634279_at:584:77; Interrogation_Position=398; Antisense; AGGATGTGGCATTCACACCGCGAAT
>probe:Drosophila_2:1634279_at:405:23; Interrogation_Position=447; Antisense; ATATCGACATGACCAGTTCGCGGGC
>probe:Drosophila_2:1634279_at:84:589; Interrogation_Position=506; Antisense; TGGAGATGACCAACTCGGACTCGAT
>probe:Drosophila_2:1634279_at:421:255; Interrogation_Position=557; Antisense; CAAATGCGGAGTGCGCCCAGGAGTA
>probe:Drosophila_2:1634279_at:441:259; Interrogation_Position=591; Antisense; CACGTCGGGAGTGATCTGTGCCAAG
>probe:Drosophila_2:1634279_at:350:153; Interrogation_Position=631; Antisense; ACAGTGTGCACTGGTGACTCTGGCG
>probe:Drosophila_2:1634279_at:413:259; Interrogation_Position=659; Antisense; CACTCGTTCTCAAGGACACTCAAAT
>probe:Drosophila_2:1634279_at:11:347; Interrogation_Position=692; Antisense; GCATAACCAGTTTCGGGCCAGCCGA
>probe:Drosophila_2:1634279_at:305:511; Interrogation_Position=722; Antisense; GTGAGACCAATATTCCCGGAGGCTT
>probe:Drosophila_2:1634279_at:151:325; Interrogation_Position=752; Antisense; GCGTCACACACTATCTGGACTGGAT

Paste this into a BLAST search page for me
GCTCCAACAAGTTCATCGTGCACGAGTGCACGAACGTTTCAATCCGGAGAAGACGGCGGCCAATGATATTGCGCTATATTGCGCTGGTCAAGCTGCCGCAAGGATGTGGCATTCACACCGCGAATATATCGACATGACCAGTTCGCGGGCTGGAGATGACCAACTCGGACTCGATCAAATGCGGAGTGCGCCCAGGAGTACACGTCGGGAGTGATCTGTGCCAAGACAGTGTGCACTGGTGACTCTGGCGCACTCGTTCTCAAGGACACTCAAATGCATAACCAGTTTCGGGCCAGCCGAGTGAGACCAATATTCCCGGAGGCTTGCGTCACACACTATCTGGACTGGAT

Full Affymetrix probeset data:

Annotations for 1634279_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime