Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634281_at:

>probe:Drosophila_2:1634281_at:130:569; Interrogation_Position=123; Antisense; GGCAGAGGACGCTCGCAAGAAGCTC
>probe:Drosophila_2:1634281_at:645:339; Interrogation_Position=252; Antisense; GCTTTTGGAGGTATCCGCTGTGGAT
>probe:Drosophila_2:1634281_at:481:161; Interrogation_Position=311; Antisense; ACAATCCAGATCTTGGTTTCTCCAC
>probe:Drosophila_2:1634281_at:615:539; Interrogation_Position=325; Antisense; GGTTTCTCCACATACGAAGCTCAAA
>probe:Drosophila_2:1634281_at:36:591; Interrogation_Position=371; Antisense; TGGTCAAGAGTATGCCTGCTCGCGA
>probe:Drosophila_2:1634281_at:267:77; Interrogation_Position=419; Antisense; AGGAGGAACTCGGTGACGCCTTCTA
>probe:Drosophila_2:1634281_at:271:609; Interrogation_Position=432; Antisense; TGACGCCTTCTACGGTGGAGCACAC
>probe:Drosophila_2:1634281_at:210:157; Interrogation_Position=455; Antisense; ACACCACTTTGCATTCGAGGACGAA
>probe:Drosophila_2:1634281_at:245:409; Interrogation_Position=474; Antisense; GACGAAGGACACTCCAGGTGCTATT
>probe:Drosophila_2:1634281_at:312:421; Interrogation_Position=520; Antisense; GAGCAGCAGATAGAGCGCCGCAAGA
>probe:Drosophila_2:1634281_at:548:319; Interrogation_Position=536; Antisense; GCCGCAAGAAGTACTCTCGCAGGAG
>probe:Drosophila_2:1634281_at:143:173; Interrogation_Position=621; Antisense; AAAGCTGGACCGCTTCTACAGCGAG
>probe:Drosophila_2:1634281_at:401:123; Interrogation_Position=640; Antisense; AGCGAGCATACAGCCGAGATCAAAC
>probe:Drosophila_2:1634281_at:302:327; Interrogation_Position=96; Antisense; GCGTACGGACAACCACCAGGAAGTG

Paste this into a BLAST search page for me
GGCAGAGGACGCTCGCAAGAAGCTCGCTTTTGGAGGTATCCGCTGTGGATACAATCCAGATCTTGGTTTCTCCACGGTTTCTCCACATACGAAGCTCAAATGGTCAAGAGTATGCCTGCTCGCGAAGGAGGAACTCGGTGACGCCTTCTATGACGCCTTCTACGGTGGAGCACACACACCACTTTGCATTCGAGGACGAAGACGAAGGACACTCCAGGTGCTATTGAGCAGCAGATAGAGCGCCGCAAGAGCCGCAAGAAGTACTCTCGCAGGAGAAAGCTGGACCGCTTCTACAGCGAGAGCGAGCATACAGCCGAGATCAAACGCGTACGGACAACCACCAGGAAGTG

Full Affymetrix probeset data:

Annotations for 1634281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime