Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634282_s_at:

>probe:Drosophila_2:1634282_s_at:570:251; Interrogation_Position=102; Antisense; CAAGCTGAAGTTTATGTACTTTGTG
>probe:Drosophila_2:1634282_s_at:381:489; Interrogation_Position=117; Antisense; GTACTTTGTGAAGAACATCGACAGC
>probe:Drosophila_2:1634282_s_at:254:597; Interrogation_Position=123; Antisense; TGTGAAGAACATCGACAGCATGGAC
>probe:Drosophila_2:1634282_s_at:246:79; Interrogation_Position=158; Antisense; AGGTATCCTTCTCGCCGCTGGCCGA
>probe:Drosophila_2:1634282_s_at:585:95; Interrogation_Position=210; Antisense; AGATTGCACTGCTCTCATTGCGATG
>probe:Drosophila_2:1634282_s_at:253:5; Interrogation_Position=212; Antisense; ATTGCACTGCTCTCATTGCGATGAG
>probe:Drosophila_2:1634282_s_at:159:9; Interrogation_Position=226; Antisense; ATTGCGATGAGACATACGCCCTGCC
>probe:Drosophila_2:1634282_s_at:691:471; Interrogation_Position=291; Antisense; GTTCTGCCCGTACTGTTACAACCAT
>probe:Drosophila_2:1634282_s_at:283:603; Interrogation_Position=304; Antisense; TGTTACAACCATCCGCCGTTCAGCG
>probe:Drosophila_2:1634282_s_at:376:293; Interrogation_Position=320; Antisense; CGTTCAGCGACATGCCCCACTTGGG
>probe:Drosophila_2:1634282_s_at:448:355; Interrogation_Position=378; Antisense; GCACTCGCTGAACACGCTGGGCATC
>probe:Drosophila_2:1634282_s_at:418:135; Interrogation_Position=391; Antisense; ACGCTGGGCATCTCCAGCTGCGTGG
>probe:Drosophila_2:1634282_s_at:515:301; Interrogation_Position=50; Antisense; CCCAGGGATCGGCTAACTTTCAGGA
>probe:Drosophila_2:1634282_s_at:152:529; Interrogation_Position=54; Antisense; GGGATCGGCTAACTTTCAGGATGTT

Paste this into a BLAST search page for me
CAAGCTGAAGTTTATGTACTTTGTGGTACTTTGTGAAGAACATCGACAGCTGTGAAGAACATCGACAGCATGGACAGGTATCCTTCTCGCCGCTGGCCGAAGATTGCACTGCTCTCATTGCGATGATTGCACTGCTCTCATTGCGATGAGATTGCGATGAGACATACGCCCTGCCGTTCTGCCCGTACTGTTACAACCATTGTTACAACCATCCGCCGTTCAGCGCGTTCAGCGACATGCCCCACTTGGGGCACTCGCTGAACACGCTGGGCATCACGCTGGGCATCTCCAGCTGCGTGGCCCAGGGATCGGCTAACTTTCAGGAGGGATCGGCTAACTTTCAGGATGTT

Full Affymetrix probeset data:

Annotations for 1634282_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime