FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634283_at:

>probe:Drosophila_2:1634283_at:288:63; Interrogation_Position=8775; Antisense; CTTGCCACTTCGAACCGAGGGAGGA
>probe:Drosophila_2:1634283_at:297:191; Interrogation_Position=8799; Antisense; AACTCCGGCTGGAAGGCGTGGCCAA
>probe:Drosophila_2:1634283_at:166:109; Interrogation_Position=8855; Antisense; AGAACCTGCCCGAGTACCAAAGAAG
>probe:Drosophila_2:1634283_at:22:13; Interrogation_Position=8885; Antisense; ATAGCAGTTTTATGCCCCACCGAAG
>probe:Drosophila_2:1634283_at:201:405; Interrogation_Position=8917; Antisense; GACTCACTGCCCTTTGATCAGAAGC
>probe:Drosophila_2:1634283_at:146:331; Interrogation_Position=8992; Antisense; GCGGTTCCCAGTAGTCAGCAAGCAA
>probe:Drosophila_2:1634283_at:542:633; Interrogation_Position=9006; Antisense; TCAGCAAGCAACACCGGCGGACATG
>probe:Drosophila_2:1634283_at:510:401; Interrogation_Position=9025; Antisense; GACATGCGACGTCCGGACTCGTATT
>probe:Drosophila_2:1634283_at:472:405; Interrogation_Position=9040; Antisense; GACTCGTATTATACTGCCGTCAGGA
>probe:Drosophila_2:1634283_at:520:91; Interrogation_Position=9078; Antisense; AGTATCACATTACCGGACACCGAGG
>probe:Drosophila_2:1634283_at:82:695; Interrogation_Position=9176; Antisense; TTTACCAAACCGCATCCGAGGAGTC
>probe:Drosophila_2:1634283_at:237:549; Interrogation_Position=9252; Antisense; GGAGGCTCTACTCGAAACAGATTTC
>probe:Drosophila_2:1634283_at:640:451; Interrogation_Position=9290; Antisense; GATCGGTTGGTCTGCAGCCACTGCA
>probe:Drosophila_2:1634283_at:426:373; Interrogation_Position=9326; Antisense; GAAGTCACAGTCAGCCCCTGGAAAC

Paste this into a BLAST search page for me
CTTGCCACTTCGAACCGAGGGAGGAAACTCCGGCTGGAAGGCGTGGCCAAAGAACCTGCCCGAGTACCAAAGAAGATAGCAGTTTTATGCCCCACCGAAGGACTCACTGCCCTTTGATCAGAAGCGCGGTTCCCAGTAGTCAGCAAGCAATCAGCAAGCAACACCGGCGGACATGGACATGCGACGTCCGGACTCGTATTGACTCGTATTATACTGCCGTCAGGAAGTATCACATTACCGGACACCGAGGTTTACCAAACCGCATCCGAGGAGTCGGAGGCTCTACTCGAAACAGATTTCGATCGGTTGGTCTGCAGCCACTGCAGAAGTCACAGTCAGCCCCTGGAAAC

Full Affymetrix probeset data:

Annotations for 1634283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720