FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634284_at:

>probe:Drosophila_2:1634284_at:378:265; Interrogation_Position=1033; Antisense; CAGAGCTCCTTTGTGCAGAAGTCCA
>probe:Drosophila_2:1634284_at:677:631; Interrogation_Position=1071; Antisense; TCCCTCGGCGCCATCAAGGAAGTAT
>probe:Drosophila_2:1634284_at:224:485; Interrogation_Position=1092; Antisense; GTATGTGCCGGCAAAGACTTTTTAA
>probe:Drosophila_2:1634284_at:394:493; Interrogation_Position=1126; Antisense; GTAAGAATCCTATCGCTTTCATTGT
>probe:Drosophila_2:1634284_at:7:293; Interrogation_Position=654; Antisense; CGTCATCTACGTGCTCTCTAAAAAG
>probe:Drosophila_2:1634284_at:729:265; Interrogation_Position=671; Antisense; CTAAAAAGCCCGATCTCACTGAGAT
>probe:Drosophila_2:1634284_at:368:113; Interrogation_Position=701; Antisense; AGCAGCTGCAGGTTACCCAGTCTGA
>probe:Drosophila_2:1634284_at:160:671; Interrogation_Position=714; Antisense; TACCCAGTCTGAGGCCAAGGTTCAA
>probe:Drosophila_2:1634284_at:55:175; Interrogation_Position=738; Antisense; AAAGCCGGAGGTCTACTTCATTAAG
>probe:Drosophila_2:1634284_at:77:665; Interrogation_Position=763; Antisense; TACAAGACCCAGGAAGAGGCCCAGC
>probe:Drosophila_2:1634284_at:498:265; Interrogation_Position=811; Antisense; CAGTACGACGCCTTGGGAGGTGCAA
>probe:Drosophila_2:1634284_at:442:533; Interrogation_Position=829; Antisense; GGTGCAACCCACATTTCGGACGAGG
>probe:Drosophila_2:1634284_at:426:203; Interrogation_Position=957; Antisense; AACCATTATCCAGCCACAGGGTCAG
>probe:Drosophila_2:1634284_at:574:473; Interrogation_Position=988; Antisense; GTTCAGCTGCAGTCTATTAACCAGG

Paste this into a BLAST search page for me
CAGAGCTCCTTTGTGCAGAAGTCCATCCCTCGGCGCCATCAAGGAAGTATGTATGTGCCGGCAAAGACTTTTTAAGTAAGAATCCTATCGCTTTCATTGTCGTCATCTACGTGCTCTCTAAAAAGCTAAAAAGCCCGATCTCACTGAGATAGCAGCTGCAGGTTACCCAGTCTGATACCCAGTCTGAGGCCAAGGTTCAAAAAGCCGGAGGTCTACTTCATTAAGTACAAGACCCAGGAAGAGGCCCAGCCAGTACGACGCCTTGGGAGGTGCAAGGTGCAACCCACATTTCGGACGAGGAACCATTATCCAGCCACAGGGTCAGGTTCAGCTGCAGTCTATTAACCAGG

Full Affymetrix probeset data:

Annotations for 1634284_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720