FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634286_at:

>probe:Drosophila_2:1634286_at:683:137; Interrogation_Position=222; Antisense; ACGATGGCTCAGTTGCGACGGATAA
>probe:Drosophila_2:1634286_at:419:655; Interrogation_Position=244; Antisense; TAATCCAAGGTCACCTGGAGCGCTT
>probe:Drosophila_2:1634286_at:314:175; Interrogation_Position=345; Antisense; AAACCGCTGGCGATGCAATTGTGGG
>probe:Drosophila_2:1634286_at:60:249; Interrogation_Position=361; Antisense; AATTGTGGGTGGTTCGCACGCCCGC
>probe:Drosophila_2:1634286_at:701:575; Interrogation_Position=398; Antisense; GGCCTCGGATAACGTCCTCGATTAC
>probe:Drosophila_2:1634286_at:114:633; Interrogation_Position=446; Antisense; TCCGAAGGACTACGCGCACAAGTTC
>probe:Drosophila_2:1634286_at:417:593; Interrogation_Position=488; Antisense; TGTGGTACCCGGAAGCTCTTACATA
>probe:Drosophila_2:1634286_at:427:673; Interrogation_Position=511; Antisense; TACCGCTGCGGTTGCTGGTGATAAA
>probe:Drosophila_2:1634286_at:431:21; Interrogation_Position=548; Antisense; ATATATGAATCTTGGGCGGCGGCTT
>probe:Drosophila_2:1634286_at:680:561; Interrogation_Position=603; Antisense; GGAATGCCGATACCCGACACTTAAT
>probe:Drosophila_2:1634286_at:51:157; Interrogation_Position=619; Antisense; ACACTTAATGCCCAACCAGTAGTTG
>probe:Drosophila_2:1634286_at:57:725; Interrogation_Position=649; Antisense; TTGGCTTTAAGCTTACTGGTTCCTA
>probe:Drosophila_2:1634286_at:697:589; Interrogation_Position=665; Antisense; TGGTTCCTAGCGCTAGTCTAGCAAT
>probe:Drosophila_2:1634286_at:344:511; Interrogation_Position=756; Antisense; GTGACTAAGACTTCCGACCTTATCG

Paste this into a BLAST search page for me
ACGATGGCTCAGTTGCGACGGATAATAATCCAAGGTCACCTGGAGCGCTTAAACCGCTGGCGATGCAATTGTGGGAATTGTGGGTGGTTCGCACGCCCGCGGCCTCGGATAACGTCCTCGATTACTCCGAAGGACTACGCGCACAAGTTCTGTGGTACCCGGAAGCTCTTACATATACCGCTGCGGTTGCTGGTGATAAAATATATGAATCTTGGGCGGCGGCTTGGAATGCCGATACCCGACACTTAATACACTTAATGCCCAACCAGTAGTTGTTGGCTTTAAGCTTACTGGTTCCTATGGTTCCTAGCGCTAGTCTAGCAATGTGACTAAGACTTCCGACCTTATCG

Full Affymetrix probeset data:

Annotations for 1634286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720