FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634289_at:

>probe:Drosophila_2:1634289_at:167:191; Interrogation_Position=4286; Antisense; AACTTCCTATATATTTGTATCCGCT
>probe:Drosophila_2:1634289_at:14:727; Interrogation_Position=4300; Antisense; TTGTATCCGCTTATACTGAGATATT
>probe:Drosophila_2:1634289_at:588:211; Interrogation_Position=4333; Antisense; AAGAGTCACCATTTCCTTTTATGAA
>probe:Drosophila_2:1634289_at:83:85; Interrogation_Position=4380; Antisense; AGTGTAGCTTTCATATCCAAATCGA
>probe:Drosophila_2:1634289_at:35:689; Interrogation_Position=4409; Antisense; TATTCAAGGATTACCAACCGCCCCG
>probe:Drosophila_2:1634289_at:725:389; Interrogation_Position=4447; Antisense; GAAACATGATCCTAACGCTTTTAAT
>probe:Drosophila_2:1634289_at:647:615; Interrogation_Position=4488; Antisense; TGCAACCACAAACAATTCCAGATGA
>probe:Drosophila_2:1634289_at:473:463; Interrogation_Position=4530; Antisense; GATTGAACTCGAATCGTTGCCGATC
>probe:Drosophila_2:1634289_at:535:291; Interrogation_Position=4544; Antisense; CGTTGCCGATCCAAACAAATCCTAT
>probe:Drosophila_2:1634289_at:597:179; Interrogation_Position=4556; Antisense; AAACAAATCCTATCCTCCAATCCAT
>probe:Drosophila_2:1634289_at:366:233; Interrogation_Position=4574; Antisense; AATCCATCCTACTTAGCTAGGCGTG
>probe:Drosophila_2:1634289_at:267:279; Interrogation_Position=4590; Antisense; CTAGGCGTGTGTGTAATGTGTGTAT
>probe:Drosophila_2:1634289_at:126:603; Interrogation_Position=4647; Antisense; TGTTGTAAATCTGTTGCCTTCGTGC
>probe:Drosophila_2:1634289_at:381:281; Interrogation_Position=4671; Antisense; CTCTATGCGGCCTTCTTCAAAACGT

Paste this into a BLAST search page for me
AACTTCCTATATATTTGTATCCGCTTTGTATCCGCTTATACTGAGATATTAAGAGTCACCATTTCCTTTTATGAAAGTGTAGCTTTCATATCCAAATCGATATTCAAGGATTACCAACCGCCCCGGAAACATGATCCTAACGCTTTTAATTGCAACCACAAACAATTCCAGATGAGATTGAACTCGAATCGTTGCCGATCCGTTGCCGATCCAAACAAATCCTATAAACAAATCCTATCCTCCAATCCATAATCCATCCTACTTAGCTAGGCGTGCTAGGCGTGTGTGTAATGTGTGTATTGTTGTAAATCTGTTGCCTTCGTGCCTCTATGCGGCCTTCTTCAAAACGT

Full Affymetrix probeset data:

Annotations for 1634289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720