Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634292_at:

>probe:Drosophila_2:1634292_at:346:491; Interrogation_Position=1269; Antisense; GTACACACCAGACTGTGTGCCTGTG
>probe:Drosophila_2:1634292_at:582:597; Interrogation_Position=1284; Antisense; TGTGCCTGTGTTTGTCCTGAGCAAC
>probe:Drosophila_2:1634292_at:121:359; Interrogation_Position=1304; Antisense; GCAACCCTCGCTAATGAAGCTGCAG
>probe:Drosophila_2:1634292_at:543:117; Interrogation_Position=1327; Antisense; AGCTCAGCTATGTTTGCACACGCAA
>probe:Drosophila_2:1634292_at:246:617; Interrogation_Position=1341; Antisense; TGCACACGCAATTTGGCTTCGCCTT
>probe:Drosophila_2:1634292_at:56:313; Interrogation_Position=1487; Antisense; GCCAGGGCCAGGGATTATCACCAGC
>probe:Drosophila_2:1634292_at:706:685; Interrogation_Position=1502; Antisense; TATCACCAGCAGCAATAGACCGAGT
>probe:Drosophila_2:1634292_at:725:217; Interrogation_Position=1552; Antisense; AAGTCCGCATGAGCCGAATAATTGA
>probe:Drosophila_2:1634292_at:292:245; Interrogation_Position=1571; Antisense; AATTGATACCCTGTCGGTTGGCCTA
>probe:Drosophila_2:1634292_at:70:457; Interrogation_Position=1605; Antisense; GATACTTTTCAAATCGTCCGCGAGA
>probe:Drosophila_2:1634292_at:443:639; Interrogation_Position=1618; Antisense; TCGTCCGCGAGAGCTCTGAACAATA
>probe:Drosophila_2:1634292_at:248:167; Interrogation_Position=1654; Antisense; AAATGACTACTGTGTCCGCTCGTAA
>probe:Drosophila_2:1634292_at:355:179; Interrogation_Position=1682; Antisense; AAAAGTTGTTGGCTCGTAGACGAAT
>probe:Drosophila_2:1634292_at:552:367; Interrogation_Position=1703; Antisense; GAATCGGTACAGCTCAAACCACCAT

Paste this into a BLAST search page for me
GTACACACCAGACTGTGTGCCTGTGTGTGCCTGTGTTTGTCCTGAGCAACGCAACCCTCGCTAATGAAGCTGCAGAGCTCAGCTATGTTTGCACACGCAATGCACACGCAATTTGGCTTCGCCTTGCCAGGGCCAGGGATTATCACCAGCTATCACCAGCAGCAATAGACCGAGTAAGTCCGCATGAGCCGAATAATTGAAATTGATACCCTGTCGGTTGGCCTAGATACTTTTCAAATCGTCCGCGAGATCGTCCGCGAGAGCTCTGAACAATAAAATGACTACTGTGTCCGCTCGTAAAAAAGTTGTTGGCTCGTAGACGAATGAATCGGTACAGCTCAAACCACCAT

Full Affymetrix probeset data:

Annotations for 1634292_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime