Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634293_at:

>probe:Drosophila_2:1634293_at:422:247; Interrogation_Position=1984; Antisense; CAATTTTGAGCTGTTAGTGGACTTT
>probe:Drosophila_2:1634293_at:629:555; Interrogation_Position=2002; Antisense; GGACTTTAGTTAACGCACTGGGAGC
>probe:Drosophila_2:1634293_at:198:363; Interrogation_Position=2039; Antisense; GCAATAAAACTTTCCTTTCCTCAGA
>probe:Drosophila_2:1634293_at:4:263; Interrogation_Position=2060; Antisense; CAGAAAACTTTTCCGCAGAACTCGC
>probe:Drosophila_2:1634293_at:27:351; Interrogation_Position=2074; Antisense; GCAGAACTCGCCCTTAGATTAGTTA
>probe:Drosophila_2:1634293_at:54:481; Interrogation_Position=2231; Antisense; TCGTTAGTCCCGTACCGTAGCAAAG
>probe:Drosophila_2:1634293_at:555:487; Interrogation_Position=2242; Antisense; GTACCGTAGCAAAGACGCGGCTGAT
>probe:Drosophila_2:1634293_at:475:411; Interrogation_Position=2255; Antisense; GACGCGGCTGATTGATGTTTCTTAA
>probe:Drosophila_2:1634293_at:643:527; Interrogation_Position=2300; Antisense; GGGACAGCCTTGGTAATTTCAATTA
>probe:Drosophila_2:1634293_at:26:175; Interrogation_Position=2350; Antisense; AAACGTCGTCTTCTTCATTGACTTA
>probe:Drosophila_2:1634293_at:147:529; Interrogation_Position=2440; Antisense; GGGACTGGCATAAGTGAACCCACAA
>probe:Drosophila_2:1634293_at:393:511; Interrogation_Position=2453; Antisense; GTGAACCCACAATATGATAAACCTT
>probe:Drosophila_2:1634293_at:511:453; Interrogation_Position=2468; Antisense; GATAAACCTTGAATCTGTCGAAATT
>probe:Drosophila_2:1634293_at:275:233; Interrogation_Position=2499; Antisense; AATGCACTGTTGTCAAACCGCTTTG

Paste this into a BLAST search page for me
CAATTTTGAGCTGTTAGTGGACTTTGGACTTTAGTTAACGCACTGGGAGCGCAATAAAACTTTCCTTTCCTCAGACAGAAAACTTTTCCGCAGAACTCGCGCAGAACTCGCCCTTAGATTAGTTATCGTTAGTCCCGTACCGTAGCAAAGGTACCGTAGCAAAGACGCGGCTGATGACGCGGCTGATTGATGTTTCTTAAGGGACAGCCTTGGTAATTTCAATTAAAACGTCGTCTTCTTCATTGACTTAGGGACTGGCATAAGTGAACCCACAAGTGAACCCACAATATGATAAACCTTGATAAACCTTGAATCTGTCGAAATTAATGCACTGTTGTCAAACCGCTTTG

Full Affymetrix probeset data:

Annotations for 1634293_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime