FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634295_at:

>probe:Drosophila_2:1634295_at:607:151; Interrogation_Position=2042; Antisense; ACATGGAGCACTTGATGCACCGCAT
>probe:Drosophila_2:1634295_at:589:95; Interrogation_Position=2125; Antisense; AGATTGGGAATCTTCGCCTGCATCA
>probe:Drosophila_2:1634295_at:170:393; Interrogation_Position=2183; Antisense; GAAAGAGTCATCGTCTGGCCATGGC
>probe:Drosophila_2:1634295_at:717:287; Interrogation_Position=2197; Antisense; CTGGCCATGGCCATCTTTATGATAT
>probe:Drosophila_2:1634295_at:149:459; Interrogation_Position=2217; Antisense; GATATTATGGATGTCGGCGCTGGCA
>probe:Drosophila_2:1634295_at:279:577; Interrogation_Position=2232; Antisense; GGCGCTGGCATCATCCATATTGGAT
>probe:Drosophila_2:1634295_at:597:457; Interrogation_Position=2254; Antisense; GATAGTATTCCGGTGGCAGCCATAA
>probe:Drosophila_2:1634295_at:345:229; Interrogation_Position=2377; Antisense; AATGGAACGCTCTATGGCGCATCAG
>probe:Drosophila_2:1634295_at:272:575; Interrogation_Position=2392; Antisense; GGCGCATCAGCCAATGTCATTGCAG
>probe:Drosophila_2:1634295_at:570:65; Interrogation_Position=2435; Antisense; ATGGCTATAAGTTGTCCTTCACCCG
>probe:Drosophila_2:1634295_at:547:423; Interrogation_Position=2466; Antisense; GAGAACAGTTTTTCCCATGATGCTG
>probe:Drosophila_2:1634295_at:229:607; Interrogation_Position=2483; Antisense; TGATGCTGGGACAGATCACCCTGAT
>probe:Drosophila_2:1634295_at:21:57; Interrogation_Position=2506; Antisense; ATGACTGTCTATCTACTGGTGGCGC
>probe:Drosophila_2:1634295_at:444:143; Interrogation_Position=2520; Antisense; ACTGGTGGCGCATGTGGTCTTTGAA

Paste this into a BLAST search page for me
ACATGGAGCACTTGATGCACCGCATAGATTGGGAATCTTCGCCTGCATCAGAAAGAGTCATCGTCTGGCCATGGCCTGGCCATGGCCATCTTTATGATATGATATTATGGATGTCGGCGCTGGCAGGCGCTGGCATCATCCATATTGGATGATAGTATTCCGGTGGCAGCCATAAAATGGAACGCTCTATGGCGCATCAGGGCGCATCAGCCAATGTCATTGCAGATGGCTATAAGTTGTCCTTCACCCGGAGAACAGTTTTTCCCATGATGCTGTGATGCTGGGACAGATCACCCTGATATGACTGTCTATCTACTGGTGGCGCACTGGTGGCGCATGTGGTCTTTGAA

Full Affymetrix probeset data:

Annotations for 1634295_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720