Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634297_at:

>probe:Drosophila_2:1634297_at:192:723; Interrogation_Position=1347; Antisense; TTGCGTCATGTTAGTCGAGATTTTC
>probe:Drosophila_2:1634297_at:375:291; Interrogation_Position=1378; Antisense; CGGGCAGGCAGCACGAAACGATTGT
>probe:Drosophila_2:1634297_at:240:347; Interrogation_Position=1414; Antisense; GCATCGTTGTGCTGGACACGTTTAA
>probe:Drosophila_2:1634297_at:136:479; Interrogation_Position=1433; Antisense; GTTTAATATGCAACGCGACGAGCGT
>probe:Drosophila_2:1634297_at:208:267; Interrogation_Position=1475; Antisense; CAGGCAATTCGATCCGCAGCGGTTT
>probe:Drosophila_2:1634297_at:330:297; Interrogation_Position=1489; Antisense; CGCAGCGGTTTCTCGATCAGGAAGA
>probe:Drosophila_2:1634297_at:325:371; Interrogation_Position=1561; Antisense; GAAGGCAGCGTGATCGTCGACACTC
>probe:Drosophila_2:1634297_at:186:637; Interrogation_Position=1574; Antisense; TCGTCGACACTCCTACAGCTTTTTG
>probe:Drosophila_2:1634297_at:626:713; Interrogation_Position=1602; Antisense; TTCTCCAATGGACTGCGATCGTGTA
>probe:Drosophila_2:1634297_at:196:451; Interrogation_Position=1618; Antisense; GATCGTGTATTGGTCGTCGCTATGG
>probe:Drosophila_2:1634297_at:204:371; Interrogation_Position=1655; Antisense; GAAGGTCTTCCTGGTCAAGTTGATA
>probe:Drosophila_2:1634297_at:673:551; Interrogation_Position=1712; Antisense; GGAGAAGCTGCAGTTTGTCGAAAAT
>probe:Drosophila_2:1634297_at:152:299; Interrogation_Position=1757; Antisense; CGCCGATGACATCTTGCTGACAATT
>probe:Drosophila_2:1634297_at:336:549; Interrogation_Position=1793; Antisense; GGAGTCCACTTGAGATGCATTGTTT

Paste this into a BLAST search page for me
TTGCGTCATGTTAGTCGAGATTTTCCGGGCAGGCAGCACGAAACGATTGTGCATCGTTGTGCTGGACACGTTTAAGTTTAATATGCAACGCGACGAGCGTCAGGCAATTCGATCCGCAGCGGTTTCGCAGCGGTTTCTCGATCAGGAAGAGAAGGCAGCGTGATCGTCGACACTCTCGTCGACACTCCTACAGCTTTTTGTTCTCCAATGGACTGCGATCGTGTAGATCGTGTATTGGTCGTCGCTATGGGAAGGTCTTCCTGGTCAAGTTGATAGGAGAAGCTGCAGTTTGTCGAAAATCGCCGATGACATCTTGCTGACAATTGGAGTCCACTTGAGATGCATTGTTT

Full Affymetrix probeset data:

Annotations for 1634297_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime