Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634298_at:

>probe:Drosophila_2:1634298_at:53:687; Interrogation_Position=1094; Antisense; TATACCTGGTTATCACACTTTATGG
>probe:Drosophila_2:1634298_at:18:259; Interrogation_Position=570; Antisense; CACTGATCATGTGGTGCTGGCCATG
>probe:Drosophila_2:1634298_at:550:81; Interrogation_Position=599; Antisense; AGGGCACACTCTTCAGCGGCGATTG
>probe:Drosophila_2:1634298_at:230:327; Interrogation_Position=617; Antisense; GCGATTGCATCCTTGGCGAGGGCAC
>probe:Drosophila_2:1634298_at:191:317; Interrogation_Position=643; Antisense; GCCGTCTTCGAGGACCTATTTGAGT
>probe:Drosophila_2:1634298_at:114:457; Interrogation_Position=687; Antisense; GATACTAGACATCAAGCCGCAGCGT
>probe:Drosophila_2:1634298_at:500:121; Interrogation_Position=707; Antisense; AGCGTATCTTTCCAGGCCATGGCAA
>probe:Drosophila_2:1634298_at:525:489; Interrogation_Position=762; Antisense; GTACTACATTAACCATCGCAACCAG
>probe:Drosophila_2:1634298_at:22:619; Interrogation_Position=803; Antisense; TGCAGTTCTTCGTTCAGCGGCCCAA
>probe:Drosophila_2:1634298_at:561:191; Interrogation_Position=832; Antisense; AACTTGCAGGCTATGGACGTCGTGA
>probe:Drosophila_2:1634298_at:206:511; Interrogation_Position=910; Antisense; GTGAACCACCACCTAAGCAAGCTGG
>probe:Drosophila_2:1634298_at:677:391; Interrogation_Position=944; Antisense; GAAAGCTGCGGGTCAGCAAGTCTGC
>probe:Drosophila_2:1634298_at:587:375; Interrogation_Position=973; Antisense; GAAGAGTTCTATGTGTACCAGCCAA
>probe:Drosophila_2:1634298_at:373:203; Interrogation_Position=996; Antisense; AACCAGTGCGCTCTAAATTCTTGAT

Paste this into a BLAST search page for me
TATACCTGGTTATCACACTTTATGGCACTGATCATGTGGTGCTGGCCATGAGGGCACACTCTTCAGCGGCGATTGGCGATTGCATCCTTGGCGAGGGCACGCCGTCTTCGAGGACCTATTTGAGTGATACTAGACATCAAGCCGCAGCGTAGCGTATCTTTCCAGGCCATGGCAAGTACTACATTAACCATCGCAACCAGTGCAGTTCTTCGTTCAGCGGCCCAAAACTTGCAGGCTATGGACGTCGTGAGTGAACCACCACCTAAGCAAGCTGGGAAAGCTGCGGGTCAGCAAGTCTGCGAAGAGTTCTATGTGTACCAGCCAAAACCAGTGCGCTCTAAATTCTTGAT

Full Affymetrix probeset data:

Annotations for 1634298_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime