FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634299_at:

>probe:Drosophila_2:1634299_at:698:279; Interrogation_Position=1090; Antisense; CTAAGCAATCATCACAGTCTCCAGA
>probe:Drosophila_2:1634299_at:268:287; Interrogation_Position=1142; Antisense; CTGGTCGCTCGGCATCCAAAGAAAA
>probe:Drosophila_2:1634299_at:413:77; Interrogation_Position=1181; Antisense; AGGATACTCAGCATTCTGCAGCAAT
>probe:Drosophila_2:1634299_at:295:173; Interrogation_Position=654; Antisense; AAAGCAGAGCGTGCAGGTCACAAGT
>probe:Drosophila_2:1634299_at:314:219; Interrogation_Position=675; Antisense; AAGTGAATCCAATCCTCAGGCAGAC
>probe:Drosophila_2:1634299_at:160:73; Interrogation_Position=692; Antisense; AGGCAGACTGTGACGTTCCTGTCGC
>probe:Drosophila_2:1634299_at:62:721; Interrogation_Position=707; Antisense; TTCCTGTCGCTTGCCGAAAGCAGTG
>probe:Drosophila_2:1634299_at:182:267; Interrogation_Position=755; Antisense; CAGTGGCCTGTTCAACGAGTCGAAA
>probe:Drosophila_2:1634299_at:342:373; Interrogation_Position=784; Antisense; GAAGTCCGAGCTCCAATGAATACAA
>probe:Drosophila_2:1634299_at:585:365; Interrogation_Position=801; Antisense; GAATACAACTATGATCTCCACACCG
>probe:Drosophila_2:1634299_at:221:257; Interrogation_Position=819; Antisense; CACACCGGAGTTCTATAATCCTGGA
>probe:Drosophila_2:1634299_at:385:653; Interrogation_Position=834; Antisense; TAATCCTGGAGAGCGAGAACTACTA
>probe:Drosophila_2:1634299_at:15:559; Interrogation_Position=885; Antisense; GGAACGCTTTCTTAGTGGCGAAGAC
>probe:Drosophila_2:1634299_at:450:31; Interrogation_Position=938; Antisense; ATAACACTTTGCTGGATGATCTGAA

Paste this into a BLAST search page for me
CTAAGCAATCATCACAGTCTCCAGACTGGTCGCTCGGCATCCAAAGAAAAAGGATACTCAGCATTCTGCAGCAATAAAGCAGAGCGTGCAGGTCACAAGTAAGTGAATCCAATCCTCAGGCAGACAGGCAGACTGTGACGTTCCTGTCGCTTCCTGTCGCTTGCCGAAAGCAGTGCAGTGGCCTGTTCAACGAGTCGAAAGAAGTCCGAGCTCCAATGAATACAAGAATACAACTATGATCTCCACACCGCACACCGGAGTTCTATAATCCTGGATAATCCTGGAGAGCGAGAACTACTAGGAACGCTTTCTTAGTGGCGAAGACATAACACTTTGCTGGATGATCTGAA

Full Affymetrix probeset data:

Annotations for 1634299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720