FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634300_at:

>probe:Drosophila_2:1634300_at:548:277; Interrogation_Position=1040; Antisense; CTTTCTCTGTCGGATTGCTGTGATA
>probe:Drosophila_2:1634300_at:712:457; Interrogation_Position=1061; Antisense; GATATGTGCAAAGTGTTTCCCAAAG
>probe:Drosophila_2:1634300_at:411:303; Interrogation_Position=1151; Antisense; CCGCGTTCGTTTTTTCAATACACAT
>probe:Drosophila_2:1634300_at:122:443; Interrogation_Position=647; Antisense; GATGTCGCACATCCTCTTCAAAGGA
>probe:Drosophila_2:1634300_at:689:109; Interrogation_Position=673; Antisense; AGAATCCTCGAAAGTGGTATCCCTC
>probe:Drosophila_2:1634300_at:245:141; Interrogation_Position=700; Antisense; ACGGCGGCTGGTACTTCCACGTGGT
>probe:Drosophila_2:1634300_at:688:627; Interrogation_Position=715; Antisense; TCCACGTGGTCAGCTCTATTTCAGA
>probe:Drosophila_2:1634300_at:17:645; Interrogation_Position=729; Antisense; TCTATTTCAGAGTGGGTCATCGCCA
>probe:Drosophila_2:1634300_at:89:705; Interrogation_Position=769; Antisense; TTATCCTCTCCTTCACGAATGAGTT
>probe:Drosophila_2:1634300_at:537:95; Interrogation_Position=820; Antisense; AGATTGCCCTGATGTCCTATTCGAC
>probe:Drosophila_2:1634300_at:46:687; Interrogation_Position=837; Antisense; TATTCGACCACCATCTAGAGCTTAC
>probe:Drosophila_2:1634300_at:207:677; Interrogation_Position=852; Antisense; TAGAGCTTACCTTCATAGATCAGAA
>probe:Drosophila_2:1634300_at:203:497; Interrogation_Position=898; Antisense; GTCTGAAGTAGGCAGCGGTTCCTTC
>probe:Drosophila_2:1634300_at:601:467; Interrogation_Position=915; Antisense; GTTCCTTCACCTTCAACATTTTAAG

Paste this into a BLAST search page for me
CTTTCTCTGTCGGATTGCTGTGATAGATATGTGCAAAGTGTTTCCCAAAGCCGCGTTCGTTTTTTCAATACACATGATGTCGCACATCCTCTTCAAAGGAAGAATCCTCGAAAGTGGTATCCCTCACGGCGGCTGGTACTTCCACGTGGTTCCACGTGGTCAGCTCTATTTCAGATCTATTTCAGAGTGGGTCATCGCCATTATCCTCTCCTTCACGAATGAGTTAGATTGCCCTGATGTCCTATTCGACTATTCGACCACCATCTAGAGCTTACTAGAGCTTACCTTCATAGATCAGAAGTCTGAAGTAGGCAGCGGTTCCTTCGTTCCTTCACCTTCAACATTTTAAG

Full Affymetrix probeset data:

Annotations for 1634300_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720