FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634301_at:

>probe:Drosophila_2:1634301_at:147:29; Interrogation_Position=1030; Antisense; ATACGACGTGTGGTACTCGGACTCT
>probe:Drosophila_2:1634301_at:327:425; Interrogation_Position=1068; Antisense; GAGAGAGCTTCCCATCGGCTGAGAT
>probe:Drosophila_2:1634301_at:707:607; Interrogation_Position=1087; Antisense; TGAGATGACATTCTTGGCCGTGCCA
>probe:Drosophila_2:1634301_at:654:719; Interrogation_Position=1117; Antisense; TTCCGGCAGTCAGTAGGCGTGCGAA
>probe:Drosophila_2:1634301_at:624:531; Interrogation_Position=611; Antisense; GGGTGCATTCCAACGACTCGGATAA
>probe:Drosophila_2:1634301_at:602:663; Interrogation_Position=637; Antisense; TACAAGGTTATTCCGGATGCCGTCA
>probe:Drosophila_2:1634301_at:22:305; Interrogation_Position=656; Antisense; CCGTCAAGGGTTTGTGCTTCGCGCA
>probe:Drosophila_2:1634301_at:96:517; Interrogation_Position=684; Antisense; GGGCGATGGTTCGATGCTCAGCATA
>probe:Drosophila_2:1634301_at:75:181; Interrogation_Position=759; Antisense; AAAACACGGCTACACTGTCGTCTAC
>probe:Drosophila_2:1634301_at:420:463; Interrogation_Position=809; Antisense; GATTGCTGCCAGATCACATTATAAT
>probe:Drosophila_2:1634301_at:475:713; Interrogation_Position=845; Antisense; TTCAGAATGCACTTCAACCGATCAT
>probe:Drosophila_2:1634301_at:661:255; Interrogation_Position=870; Antisense; CAAAGAGCTTTTACTGGCAATCAAA
>probe:Drosophila_2:1634301_at:207:43; Interrogation_Position=917; Antisense; ATCGTGATCATGAAACTGGCAGCCA
>probe:Drosophila_2:1634301_at:699:159; Interrogation_Position=954; Antisense; ACAATCGCCAGACTGACTGATGCCG

Paste this into a BLAST search page for me
ATACGACGTGTGGTACTCGGACTCTGAGAGAGCTTCCCATCGGCTGAGATTGAGATGACATTCTTGGCCGTGCCATTCCGGCAGTCAGTAGGCGTGCGAAGGGTGCATTCCAACGACTCGGATAATACAAGGTTATTCCGGATGCCGTCACCGTCAAGGGTTTGTGCTTCGCGCAGGGCGATGGTTCGATGCTCAGCATAAAAACACGGCTACACTGTCGTCTACGATTGCTGCCAGATCACATTATAATTTCAGAATGCACTTCAACCGATCATCAAAGAGCTTTTACTGGCAATCAAAATCGTGATCATGAAACTGGCAGCCAACAATCGCCAGACTGACTGATGCCG

Full Affymetrix probeset data:

Annotations for 1634301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720