Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634305_at:

>probe:Drosophila_2:1634305_at:581:607; Interrogation_Position=1035; Antisense; TGAGAGGAATATACCGCGCCCAAAC
>probe:Drosophila_2:1634305_at:700:371; Interrogation_Position=525; Antisense; GAAGGATGTGCCACGCCGAGTGACC
>probe:Drosophila_2:1634305_at:69:95; Interrogation_Position=550; Antisense; AGTTCCTGGGCCACAGACTATGAAT
>probe:Drosophila_2:1634305_at:614:363; Interrogation_Position=571; Antisense; GAATTATTGCTCGAGGATCCGGACA
>probe:Drosophila_2:1634305_at:407:449; Interrogation_Position=586; Antisense; GATCCGGACATATTTTCGACGTGCA
>probe:Drosophila_2:1634305_at:153:313; Interrogation_Position=641; Antisense; GCCAGGCACTCAACTTAGACGACAT
>probe:Drosophila_2:1634305_at:223:667; Interrogation_Position=689; Antisense; TACTTCATGTATCCGGGAACGCCAC
>probe:Drosophila_2:1634305_at:92:261; Interrogation_Position=735; Antisense; CACCGATCGGATTACTGCGAGACTT
>probe:Drosophila_2:1634305_at:420:607; Interrogation_Position=759; Antisense; TGATGTTTTTCACTTCAACCGCGGC
>probe:Drosophila_2:1634305_at:709:723; Interrogation_Position=786; Antisense; TTGGGAGCCCACTGTCTTTAGCATG
>probe:Drosophila_2:1634305_at:176:107; Interrogation_Position=818; Antisense; AGAACTTTTGCTCCATCATGTACGA
>probe:Drosophila_2:1634305_at:644:99; Interrogation_Position=916; Antisense; AGAGGGCCTGATACCGTTCTGGTAC
>probe:Drosophila_2:1634305_at:164:415; Interrogation_Position=943; Antisense; GAGCCCTTCGATCTCATACTAAAAT
>probe:Drosophila_2:1634305_at:254:245; Interrogation_Position=973; Antisense; AATTTTCGTGGACCTCTTCTTAGAG

Paste this into a BLAST search page for me
TGAGAGGAATATACCGCGCCCAAACGAAGGATGTGCCACGCCGAGTGACCAGTTCCTGGGCCACAGACTATGAATGAATTATTGCTCGAGGATCCGGACAGATCCGGACATATTTTCGACGTGCAGCCAGGCACTCAACTTAGACGACATTACTTCATGTATCCGGGAACGCCACCACCGATCGGATTACTGCGAGACTTTGATGTTTTTCACTTCAACCGCGGCTTGGGAGCCCACTGTCTTTAGCATGAGAACTTTTGCTCCATCATGTACGAAGAGGGCCTGATACCGTTCTGGTACGAGCCCTTCGATCTCATACTAAAATAATTTTCGTGGACCTCTTCTTAGAG

Full Affymetrix probeset data:

Annotations for 1634305_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime