Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634306_at:

>probe:Drosophila_2:1634306_at:643:671; Interrogation_Position=4979; Antisense; TACGCATAGGTGTACGACTTCCAAA
>probe:Drosophila_2:1634306_at:100:677; Interrogation_Position=5021; Antisense; TAGTCTGTGATTGCCAACTGAAGTT
>probe:Drosophila_2:1634306_at:94:493; Interrogation_Position=5078; Antisense; GTAACTGAACATTTCACGAGCGAGT
>probe:Drosophila_2:1634306_at:613:491; Interrogation_Position=5107; Antisense; GTAATCCAATCCTAGGCGTAAGCTA
>probe:Drosophila_2:1634306_at:489:575; Interrogation_Position=5121; Antisense; GGCGTAAGCTACTTGTACAAATCGA
>probe:Drosophila_2:1634306_at:578:157; Interrogation_Position=5139; Antisense; AAATCGAACACTGAAGGGTCTAGGT
>probe:Drosophila_2:1634306_at:203:675; Interrogation_Position=5188; Antisense; TAGGTTCACTAGCTACTAAGTTCTA
>probe:Drosophila_2:1634306_at:151:645; Interrogation_Position=5209; Antisense; TCTAGAACTAAGTCGATGCGTCGCA
>probe:Drosophila_2:1634306_at:175:447; Interrogation_Position=5223; Antisense; GATGCGTCGCAATTAAACTACACTA
>probe:Drosophila_2:1634306_at:109:639; Interrogation_Position=5362; Antisense; TCGGCGGATCGATGGCAATAAGTGA
>probe:Drosophila_2:1634306_at:354:491; Interrogation_Position=5408; Antisense; GTAAAACCTGATGGTTCCGGCCACT
>probe:Drosophila_2:1634306_at:283:575; Interrogation_Position=5426; Antisense; GGCCACTCAAATGGAAGTCCCTCAG
>probe:Drosophila_2:1634306_at:334:649; Interrogation_Position=5447; Antisense; TCAGGGACAGGCCAATTCCACAGAG
>probe:Drosophila_2:1634306_at:241:629; Interrogation_Position=5463; Antisense; TCCACAGAGCGGCTGCTATCGTAAA

Paste this into a BLAST search page for me
TACGCATAGGTGTACGACTTCCAAATAGTCTGTGATTGCCAACTGAAGTTGTAACTGAACATTTCACGAGCGAGTGTAATCCAATCCTAGGCGTAAGCTAGGCGTAAGCTACTTGTACAAATCGAAAATCGAACACTGAAGGGTCTAGGTTAGGTTCACTAGCTACTAAGTTCTATCTAGAACTAAGTCGATGCGTCGCAGATGCGTCGCAATTAAACTACACTATCGGCGGATCGATGGCAATAAGTGAGTAAAACCTGATGGTTCCGGCCACTGGCCACTCAAATGGAAGTCCCTCAGTCAGGGACAGGCCAATTCCACAGAGTCCACAGAGCGGCTGCTATCGTAAA

Full Affymetrix probeset data:

Annotations for 1634306_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime