FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634307_at:

>probe:Drosophila_2:1634307_at:136:521; Interrogation_Position=3500; Antisense; GTGGAACATTTGAAGCCGCACCATT
>probe:Drosophila_2:1634307_at:219:379; Interrogation_Position=3511; Antisense; GAAGCCGCACCATTAGAATTTGAGT
>probe:Drosophila_2:1634307_at:2:93; Interrogation_Position=3543; Antisense; AGTTCGTGGAGTTCGCAACTATTTC
>probe:Drosophila_2:1634307_at:16:255; Interrogation_Position=3558; Antisense; CAACTATTTCTTGCATTCGTCGGTA
>probe:Drosophila_2:1634307_at:218:645; Interrogation_Position=3566; Antisense; TCTTGCATTCGTCGGTAGATACAAT
>probe:Drosophila_2:1634307_at:672:699; Interrogation_Position=3640; Antisense; TTTTGATTATGTGTACCCGTACCCA
>probe:Drosophila_2:1634307_at:654:391; Interrogation_Position=3711; Antisense; GAAACCACAATCTTACCTTATAAAT
>probe:Drosophila_2:1634307_at:698:473; Interrogation_Position=3738; Antisense; GTTAACCTTTATAATACCATGACCA
>probe:Drosophila_2:1634307_at:681:547; Interrogation_Position=3794; Antisense; GGAGTATAAACTCAGTGCAACTGCA
>probe:Drosophila_2:1634307_at:119:249; Interrogation_Position=3833; Antisense; AATTGTTACGCTCTTCATTTGTTGC
>probe:Drosophila_2:1634307_at:346:339; Interrogation_Position=3842; Antisense; GCTCTTCATTTGTTGCTTATTTATA
>probe:Drosophila_2:1634307_at:673:163; Interrogation_Position=3942; Antisense; AAATAGCAGTGCTTCGCTCACTTTT
>probe:Drosophila_2:1634307_at:95:619; Interrogation_Position=3951; Antisense; TGCTTCGCTCACTTTTAAAATGTAA
>probe:Drosophila_2:1634307_at:46:145; Interrogation_Position=3983; Antisense; ACTGAAGTCTGCCATATACCATATC

Paste this into a BLAST search page for me
GTGGAACATTTGAAGCCGCACCATTGAAGCCGCACCATTAGAATTTGAGTAGTTCGTGGAGTTCGCAACTATTTCCAACTATTTCTTGCATTCGTCGGTATCTTGCATTCGTCGGTAGATACAATTTTTGATTATGTGTACCCGTACCCAGAAACCACAATCTTACCTTATAAATGTTAACCTTTATAATACCATGACCAGGAGTATAAACTCAGTGCAACTGCAAATTGTTACGCTCTTCATTTGTTGCGCTCTTCATTTGTTGCTTATTTATAAAATAGCAGTGCTTCGCTCACTTTTTGCTTCGCTCACTTTTAAAATGTAAACTGAAGTCTGCCATATACCATATC

Full Affymetrix probeset data:

Annotations for 1634307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720