FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634309_at:

>probe:Drosophila_2:1634309_at:710:201; Interrogation_Position=4114; Antisense; AAGCCTTTGGTATCAACCGGCCAAT
>probe:Drosophila_2:1634309_at:207:287; Interrogation_Position=4131; Antisense; CGGCCAATCCATCATTGCGATCAAG
>probe:Drosophila_2:1634309_at:99:561; Interrogation_Position=4175; Antisense; GGAAAATCCTTGTGCTGGGCTGCAA
>probe:Drosophila_2:1634309_at:598:191; Interrogation_Position=4204; Antisense; AACTTTGTCCAAATGCATGATGCGG
>probe:Drosophila_2:1634309_at:146:197; Interrogation_Position=4231; Antisense; AACGGATTGCTGCTACGTCACGTAT
>probe:Drosophila_2:1634309_at:315:73; Interrogation_Position=4299; Antisense; AGGACACATTTATTGCGGAACGCAG
>probe:Drosophila_2:1634309_at:283:729; Interrogation_Position=4363; Antisense; TTGGTCACCAAGTTCAGCTGTGGAA
>probe:Drosophila_2:1634309_at:336:169; Interrogation_Position=4386; Antisense; AAATGGCGCTGTTGCTGTTGCGGCC
>probe:Drosophila_2:1634309_at:239:121; Interrogation_Position=4418; Antisense; AGCGTTATTTGCTAGTCGGCTGCTA
>probe:Drosophila_2:1634309_at:696:287; Interrogation_Position=4434; Antisense; CGGCTGCTACGACGGCTATATTTAC
>probe:Drosophila_2:1634309_at:694:377; Interrogation_Position=4478; Antisense; GAACTCAAACTGGTCGTTTCGCTGG
>probe:Drosophila_2:1634309_at:350:589; Interrogation_Position=4506; Antisense; TGGTCGCATGGTTTTAGCCCTTTCG
>probe:Drosophila_2:1634309_at:33:675; Interrogation_Position=4520; Antisense; TAGCCCTTTCGGTTGTAGGCGATAA
>probe:Drosophila_2:1634309_at:56:195; Interrogation_Position=4567; Antisense; AACTCGCTGGCGATTCTGGAGGTGC

Paste this into a BLAST search page for me
AAGCCTTTGGTATCAACCGGCCAATCGGCCAATCCATCATTGCGATCAAGGGAAAATCCTTGTGCTGGGCTGCAAAACTTTGTCCAAATGCATGATGCGGAACGGATTGCTGCTACGTCACGTATAGGACACATTTATTGCGGAACGCAGTTGGTCACCAAGTTCAGCTGTGGAAAAATGGCGCTGTTGCTGTTGCGGCCAGCGTTATTTGCTAGTCGGCTGCTACGGCTGCTACGACGGCTATATTTACGAACTCAAACTGGTCGTTTCGCTGGTGGTCGCATGGTTTTAGCCCTTTCGTAGCCCTTTCGGTTGTAGGCGATAAAACTCGCTGGCGATTCTGGAGGTGC

Full Affymetrix probeset data:

Annotations for 1634309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720