Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634310_at:

>probe:Drosophila_2:1634310_at:683:509; Interrogation_Position=266; Antisense; GTGCAGGATCGATCGAACATGCTGA
>probe:Drosophila_2:1634310_at:74:335; Interrogation_Position=286; Antisense; GCTGATGTATCTAGCATTCTTGAAA
>probe:Drosophila_2:1634310_at:420:495; Interrogation_Position=317; Antisense; GTCAGAAATTAGAACCACCTGCGGT
>probe:Drosophila_2:1634310_at:284:589; Interrogation_Position=386; Antisense; TGGATTTTAGCCAGTTCTGCAAACT
>probe:Drosophila_2:1634310_at:441:177; Interrogation_Position=406; Antisense; AAACTGGCAGCTCGCTTTATTGAAG
>probe:Drosophila_2:1634310_at:183:99; Interrogation_Position=468; Antisense; AGAGGCCTTCCGTGTATATGATAAA
>probe:Drosophila_2:1634310_at:447:457; Interrogation_Position=503; Antisense; GATACCTGACAGTTGCAACACTAAG
>probe:Drosophila_2:1634310_at:98:439; Interrogation_Position=527; Antisense; GAGGCATTCTTCACGAATTGGACGA
>probe:Drosophila_2:1634310_at:141:555; Interrogation_Position=546; Antisense; GGACGATAAGCTTTCTAACCAAGAC
>probe:Drosophila_2:1634310_at:464:447; Interrogation_Position=605; Antisense; GATCCGGTACGGTTGATTTTGACGA
>probe:Drosophila_2:1634310_at:113:361; Interrogation_Position=636; Antisense; GCAAGTTATGACAGGTTGACCCACA
>probe:Drosophila_2:1634310_at:363:609; Interrogation_Position=652; Antisense; TGACCCACATTGCTCTTTTTTGACA
>probe:Drosophila_2:1634310_at:432:611; Interrogation_Position=672; Antisense; TGACATGCTGTGCAAAAGCTCAGAT
>probe:Drosophila_2:1634310_at:27:483; Interrogation_Position=785; Antisense; GTATTAGCATCATTTTTCTCTTATC

Paste this into a BLAST search page for me
GTGCAGGATCGATCGAACATGCTGAGCTGATGTATCTAGCATTCTTGAAAGTCAGAAATTAGAACCACCTGCGGTTGGATTTTAGCCAGTTCTGCAAACTAAACTGGCAGCTCGCTTTATTGAAGAGAGGCCTTCCGTGTATATGATAAAGATACCTGACAGTTGCAACACTAAGGAGGCATTCTTCACGAATTGGACGAGGACGATAAGCTTTCTAACCAAGACGATCCGGTACGGTTGATTTTGACGAGCAAGTTATGACAGGTTGACCCACATGACCCACATTGCTCTTTTTTGACATGACATGCTGTGCAAAAGCTCAGATGTATTAGCATCATTTTTCTCTTATC

Full Affymetrix probeset data:

Annotations for 1634310_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime