FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634311_at:

>probe:Drosophila_2:1634311_at:478:455; Interrogation_Position=1648; Antisense; GATAATGATCGAAAGTGCCACAAGA
>probe:Drosophila_2:1634311_at:720:355; Interrogation_Position=1696; Antisense; GCACTATTTTTGAGCATTTTTGTAA
>probe:Drosophila_2:1634311_at:161:719; Interrogation_Position=1761; Antisense; TTGTTTGGCCGCTGACACAACTTCC
>probe:Drosophila_2:1634311_at:46:301; Interrogation_Position=1786; Antisense; CCCATCACTGCACGCATACAAATAT
>probe:Drosophila_2:1634311_at:4:705; Interrogation_Position=1843; Antisense; TTAGGGCATACTTACGATCGATCCA
>probe:Drosophila_2:1634311_at:327:49; Interrogation_Position=1872; Antisense; ATCCAATTAGTCAAAAGCGTAGCGT
>probe:Drosophila_2:1634311_at:114:123; Interrogation_Position=1887; Antisense; AGCGTAGCGTACATATCATTCAAAT
>probe:Drosophila_2:1634311_at:370:181; Interrogation_Position=1914; Antisense; AAAAAGACATCAATCCCAGGTGGAT
>probe:Drosophila_2:1634311_at:455:547; Interrogation_Position=1959; Antisense; GGATGAGCCAGCAGGAATCTTTTTA
>probe:Drosophila_2:1634311_at:234:367; Interrogation_Position=1973; Antisense; GAATCTTTTTAAATCCACACCAACG
>probe:Drosophila_2:1634311_at:235:199; Interrogation_Position=1994; Antisense; AACGCACTCAGGCACGTGTGGCAAA
>probe:Drosophila_2:1634311_at:674:517; Interrogation_Position=2009; Antisense; GTGTGGCAAACTATGTTCTAATCCT
>probe:Drosophila_2:1634311_at:11:393; Interrogation_Position=2086; Antisense; GAAAGTTACATTTTATGCTGTTTAC
>probe:Drosophila_2:1634311_at:730:515; Interrogation_Position=2167; Antisense; GTGTGTACGAGCTAAATATTCGGCA

Paste this into a BLAST search page for me
GATAATGATCGAAAGTGCCACAAGAGCACTATTTTTGAGCATTTTTGTAATTGTTTGGCCGCTGACACAACTTCCCCCATCACTGCACGCATACAAATATTTAGGGCATACTTACGATCGATCCAATCCAATTAGTCAAAAGCGTAGCGTAGCGTAGCGTACATATCATTCAAATAAAAAGACATCAATCCCAGGTGGATGGATGAGCCAGCAGGAATCTTTTTAGAATCTTTTTAAATCCACACCAACGAACGCACTCAGGCACGTGTGGCAAAGTGTGGCAAACTATGTTCTAATCCTGAAAGTTACATTTTATGCTGTTTACGTGTGTACGAGCTAAATATTCGGCA

Full Affymetrix probeset data:

Annotations for 1634311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720