Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634313_s_at:

>probe:Drosophila_2:1634313_s_at:677:301; Interrogation_Position=112; Antisense; CCCGTCTGGCGCTGGTGATGAAGTC
>probe:Drosophila_2:1634313_s_at:570:441; Interrogation_Position=128; Antisense; GATGAAGTCCGGCAAATACTGCCTG
>probe:Drosophila_2:1634313_s_at:107:669; Interrogation_Position=144; Antisense; TACTGCCTGGGCTACAAGCAGACCT
>probe:Drosophila_2:1634313_s_at:5:623; Interrogation_Position=178; Antisense; TGCGCCAGGGCAAGGCCAAACTGGT
>probe:Drosophila_2:1634313_s_at:105:303; Interrogation_Position=223; Antisense; CCGCCCTGAGGAAGTCCGAGATCGA
>probe:Drosophila_2:1634313_s_at:298:451; Interrogation_Position=242; Antisense; GATCGAGTACTACGCTATGCTGGCC
>probe:Drosophila_2:1634313_s_at:533:295; Interrogation_Position=254; Antisense; CGCTATGCTGGCCAAGACTGAAGTC
>probe:Drosophila_2:1634313_s_at:390:143; Interrogation_Position=270; Antisense; ACTGAAGTCCAGCACTACAGCGGCA
>probe:Drosophila_2:1634313_s_at:182:333; Interrogation_Position=305; Antisense; GCTGGGCACCGCCTGTGGTAAATAC
>probe:Drosophila_2:1634313_s_at:467:595; Interrogation_Position=318; Antisense; TGTGGTAAATACTTCCGCGTGTGCA
>probe:Drosophila_2:1634313_s_at:686:597; Interrogation_Position=346; Antisense; TGTCCATCACCGATCCTGGAGATTC
>probe:Drosophila_2:1634313_s_at:162:589; Interrogation_Position=362; Antisense; TGGAGATTCGGACATCATCCGCTCG
>probe:Drosophila_2:1634313_s_at:382:333; Interrogation_Position=386; Antisense; GCTGGAGACGGCCTAAACATTTATT
>probe:Drosophila_2:1634313_s_at:582:255; Interrogation_Position=54; Antisense; CAAACTATCAACATGGTGGCCGTTA

Paste this into a BLAST search page for me
CCCGTCTGGCGCTGGTGATGAAGTCGATGAAGTCCGGCAAATACTGCCTGTACTGCCTGGGCTACAAGCAGACCTTGCGCCAGGGCAAGGCCAAACTGGTCCGCCCTGAGGAAGTCCGAGATCGAGATCGAGTACTACGCTATGCTGGCCCGCTATGCTGGCCAAGACTGAAGTCACTGAAGTCCAGCACTACAGCGGCAGCTGGGCACCGCCTGTGGTAAATACTGTGGTAAATACTTCCGCGTGTGCATGTCCATCACCGATCCTGGAGATTCTGGAGATTCGGACATCATCCGCTCGGCTGGAGACGGCCTAAACATTTATTCAAACTATCAACATGGTGGCCGTTA

Full Affymetrix probeset data:

Annotations for 1634313_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime