Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634316_at:

>probe:Drosophila_2:1634316_at:264:509; Interrogation_Position=3502; Antisense; GTGAAGATTATGACGCCGGATCGCG
>probe:Drosophila_2:1634316_at:321:45; Interrogation_Position=3521; Antisense; ATCGCGTCTACATCCAAACAGCTGG
>probe:Drosophila_2:1634316_at:721:371; Interrogation_Position=3612; Antisense; GAAGATTCATCCGTCGTCGGTTAAC
>probe:Drosophila_2:1634316_at:450:539; Interrogation_Position=3630; Antisense; GGTTAACTCGCAGGTGTCCGTCTTC
>probe:Drosophila_2:1634316_at:106:469; Interrogation_Position=3663; Antisense; GTTCCTCGTCTTCCAGGAGAAGGTA
>probe:Drosophila_2:1634316_at:721:37; Interrogation_Position=3700; Antisense; ATCTACATCCGCGACTGTTCGATGT
>probe:Drosophila_2:1634316_at:644:303; Interrogation_Position=3744; Antisense; CCTGTTTGCCGGCAGCGATTTTAAG
>probe:Drosophila_2:1634316_at:349:527; Interrogation_Position=3785; Antisense; GGGACTTCCTTTTTCTGCTGGAAAG
>probe:Drosophila_2:1634316_at:310:543; Interrogation_Position=3815; Antisense; GGATTATATTGAAGGCCCACGATCT
>probe:Drosophila_2:1634316_at:550:321; Interrogation_Position=3829; Antisense; GCCCACGATCTAGAGACTGCTGAGA
>probe:Drosophila_2:1634316_at:550:109; Interrogation_Position=3896; Antisense; AGAAGATTCGCGATCCGTGCCTTAA
>probe:Drosophila_2:1634316_at:320:627; Interrogation_Position=3913; Antisense; TGCCTTAATCTGCTGCACCACAAAA
>probe:Drosophila_2:1634316_at:137:183; Interrogation_Position=3935; Antisense; AAAACGGCTGCCGTATGATCGCCAA
>probe:Drosophila_2:1634316_at:375:45; Interrogation_Position=3952; Antisense; ATCGCCAACATCGTTCACTTGATTA

Paste this into a BLAST search page for me
GTGAAGATTATGACGCCGGATCGCGATCGCGTCTACATCCAAACAGCTGGGAAGATTCATCCGTCGTCGGTTAACGGTTAACTCGCAGGTGTCCGTCTTCGTTCCTCGTCTTCCAGGAGAAGGTAATCTACATCCGCGACTGTTCGATGTCCTGTTTGCCGGCAGCGATTTTAAGGGGACTTCCTTTTTCTGCTGGAAAGGGATTATATTGAAGGCCCACGATCTGCCCACGATCTAGAGACTGCTGAGAAGAAGATTCGCGATCCGTGCCTTAATGCCTTAATCTGCTGCACCACAAAAAAAACGGCTGCCGTATGATCGCCAAATCGCCAACATCGTTCACTTGATTA

Full Affymetrix probeset data:

Annotations for 1634316_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime