FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634318_at:

>probe:Drosophila_2:1634318_at:676:59; Interrogation_Position=1466; Antisense; AGGTTTCAACTAACGCTAAGCTAAG
>probe:Drosophila_2:1634318_at:255:103; Interrogation_Position=1495; Antisense; AGAGCCATAAATACACGAGCGTGCA
>probe:Drosophila_2:1634318_at:490:371; Interrogation_Position=1560; Antisense; GAAGTCCGCCTTCCGATGATCGATC
>probe:Drosophila_2:1634318_at:71:525; Interrogation_Position=1605; Antisense; GGGCGTATGCGCAACATCAATTATA
>probe:Drosophila_2:1634318_at:102:699; Interrogation_Position=1625; Antisense; TTATAACTTGGCGATTATCCCCTCG
>probe:Drosophila_2:1634318_at:356:725; Interrogation_Position=1660; Antisense; TTGATTGCTTCGCTTCGCATCGCAT
>probe:Drosophila_2:1634318_at:29:41; Interrogation_Position=1697; Antisense; ATCTGTGGCTGCATTCGCATGTGTA
>probe:Drosophila_2:1634318_at:43:531; Interrogation_Position=1739; Antisense; GGGTCAATTTTCGAGATCTGCCTAA
>probe:Drosophila_2:1634318_at:598:39; Interrogation_Position=1754; Antisense; ATCTGCCTAATGTGTAAGTCGCCTA
>probe:Drosophila_2:1634318_at:727:217; Interrogation_Position=1769; Antisense; AAGTCGCCTAATTCTAGAACCTCAC
>probe:Drosophila_2:1634318_at:540:671; Interrogation_Position=1783; Antisense; TAGAACCTCACGAACGAAACGCGTT
>probe:Drosophila_2:1634318_at:707:649; Interrogation_Position=1808; Antisense; TAGTCTTTAATTCCCTTAGGCTAAG
>probe:Drosophila_2:1634318_at:89:485; Interrogation_Position=1897; Antisense; GTAGTCCTAAGCCAACTAGTCTAAC
>probe:Drosophila_2:1634318_at:143:495; Interrogation_Position=1915; Antisense; GTCTAACTTACAAAATTCGCACGAA

Paste this into a BLAST search page for me
AGGTTTCAACTAACGCTAAGCTAAGAGAGCCATAAATACACGAGCGTGCAGAAGTCCGCCTTCCGATGATCGATCGGGCGTATGCGCAACATCAATTATATTATAACTTGGCGATTATCCCCTCGTTGATTGCTTCGCTTCGCATCGCATATCTGTGGCTGCATTCGCATGTGTAGGGTCAATTTTCGAGATCTGCCTAAATCTGCCTAATGTGTAAGTCGCCTAAAGTCGCCTAATTCTAGAACCTCACTAGAACCTCACGAACGAAACGCGTTTAGTCTTTAATTCCCTTAGGCTAAGGTAGTCCTAAGCCAACTAGTCTAACGTCTAACTTACAAAATTCGCACGAA

Full Affymetrix probeset data:

Annotations for 1634318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720