Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634319_at:

>probe:Drosophila_2:1634319_at:271:407; Interrogation_Position=1001; Antisense; GACGGAACTGCAGTTATCCAATTGC
>probe:Drosophila_2:1634319_at:27:249; Interrogation_Position=1020; Antisense; AATTGCATATTTGCCTATCAGGATA
>probe:Drosophila_2:1634319_at:31:685; Interrogation_Position=1043; Antisense; TATAGTCAAGTTGTGTCTGCCCGTT
>probe:Drosophila_2:1634319_at:594:465; Interrogation_Position=1065; Antisense; GTTGGCATAACCTTTGCTCGATTCA
>probe:Drosophila_2:1634319_at:508:619; Interrogation_Position=1079; Antisense; TGCTCGATTCACCAACTGTCCAGAT
>probe:Drosophila_2:1634319_at:579:195; Interrogation_Position=1092; Antisense; AACTGTCCAGATCTCACTGATGAAC
>probe:Drosophila_2:1634319_at:585:143; Interrogation_Position=1107; Antisense; ACTGATGAACAGCTCTTGGACTTCA
>probe:Drosophila_2:1634319_at:251:587; Interrogation_Position=1123; Antisense; TGGACTTCATCAAGGCTAATGCCGA
>probe:Drosophila_2:1634319_at:533:101; Interrogation_Position=1154; Antisense; AGAGCTTCTACTGGATCAGTGCCCA
>probe:Drosophila_2:1634319_at:225:507; Interrogation_Position=1172; Antisense; GTGCCCAGAACTGACGGAAGATCTA
>probe:Drosophila_2:1634319_at:627:449; Interrogation_Position=1191; Antisense; GATCTACTTCATGGTGTTCTTAAAG
>probe:Drosophila_2:1634319_at:314:161; Interrogation_Position=1235; Antisense; ACAAGTGCACTTGTTGCTCAGAATT
>probe:Drosophila_2:1634319_at:420:217; Interrogation_Position=1340; Antisense; AAGTTTGGAGAGTTCTGCCTCGGAG
>probe:Drosophila_2:1634319_at:204:317; Interrogation_Position=1356; Antisense; GCCTCGGAGGACATTGTGATGCACT

Paste this into a BLAST search page for me
GACGGAACTGCAGTTATCCAATTGCAATTGCATATTTGCCTATCAGGATATATAGTCAAGTTGTGTCTGCCCGTTGTTGGCATAACCTTTGCTCGATTCATGCTCGATTCACCAACTGTCCAGATAACTGTCCAGATCTCACTGATGAACACTGATGAACAGCTCTTGGACTTCATGGACTTCATCAAGGCTAATGCCGAAGAGCTTCTACTGGATCAGTGCCCAGTGCCCAGAACTGACGGAAGATCTAGATCTACTTCATGGTGTTCTTAAAGACAAGTGCACTTGTTGCTCAGAATTAAGTTTGGAGAGTTCTGCCTCGGAGGCCTCGGAGGACATTGTGATGCACT

Full Affymetrix probeset data:

Annotations for 1634319_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime