FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634320_at:

>probe:Drosophila_2:1634320_at:33:291; Interrogation_Position=100; Antisense; CGGATTTGATTTTCTGCCGCAAGCA
>probe:Drosophila_2:1634320_at:99:207; Interrogation_Position=120; Antisense; AAGCAGCCCGGCGTGGCCATTGGAC
>probe:Drosophila_2:1634320_at:703:313; Interrogation_Position=135; Antisense; GCCATTGGACGCCTGTGTGAAAAAG
>probe:Drosophila_2:1634320_at:292:171; Interrogation_Position=167; Antisense; AAAGTGTGTGATCTGCGACTCCTAC
>probe:Drosophila_2:1634320_at:615:157; Interrogation_Position=204; Antisense; ACACTGGTGCGGATCTGCGACGAGT
>probe:Drosophila_2:1634320_at:455:209; Interrogation_Position=21; Antisense; AAGAAGTCGCCGCTTTTTCAGCAAC
>probe:Drosophila_2:1634320_at:371:81; Interrogation_Position=226; Antisense; AGTGCAACTACGGATCCTACCAGGG
>probe:Drosophila_2:1634320_at:233:673; Interrogation_Position=243; Antisense; TACCAGGGCAGGTGCGTCATCTGTG
>probe:Drosophila_2:1634320_at:559:615; Interrogation_Position=297; Antisense; TGCAAGTCCTGCACCATTCAGGAAA
>probe:Drosophila_2:1634320_at:695:407; Interrogation_Position=330; Antisense; GACGGATGCCCCAAGATTGTAAATC
>probe:Drosophila_2:1634320_at:701:599; Interrogation_Position=347; Antisense; TGTAAATCTAGGCAGCTCCAAGACT
>probe:Drosophila_2:1634320_at:301:251; Interrogation_Position=365; Antisense; CAAGACTGACCTGTTCTACGAACGC
>probe:Drosophila_2:1634320_at:202:107; Interrogation_Position=409; Antisense; AGAACTATTAATCTGCTCTCCGCTA
>probe:Drosophila_2:1634320_at:630:647; Interrogation_Position=82; Antisense; TCATGGCCAAACATCATCCGGATTT

Paste this into a BLAST search page for me
CGGATTTGATTTTCTGCCGCAAGCAAAGCAGCCCGGCGTGGCCATTGGACGCCATTGGACGCCTGTGTGAAAAAGAAAGTGTGTGATCTGCGACTCCTACACACTGGTGCGGATCTGCGACGAGTAAGAAGTCGCCGCTTTTTCAGCAACAGTGCAACTACGGATCCTACCAGGGTACCAGGGCAGGTGCGTCATCTGTGTGCAAGTCCTGCACCATTCAGGAAAGACGGATGCCCCAAGATTGTAAATCTGTAAATCTAGGCAGCTCCAAGACTCAAGACTGACCTGTTCTACGAACGCAGAACTATTAATCTGCTCTCCGCTATCATGGCCAAACATCATCCGGATTT

Full Affymetrix probeset data:

Annotations for 1634320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720