Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634321_s_at:

>probe:Drosophila_2:1634321_s_at:169:33; Interrogation_Position=119; Antisense; ATCAACAATGATGCCCTGACCTTTC
>probe:Drosophila_2:1634321_s_at:106:407; Interrogation_Position=181; Antisense; GACGATTTTCGGCTACCAGGACTTG
>probe:Drosophila_2:1634321_s_at:130:269; Interrogation_Position=197; Antisense; CAGGACTTGCACGTCCGTGTAATGT
>probe:Drosophila_2:1634321_s_at:693:227; Interrogation_Position=217; Antisense; AATGTACACGGCAGGACCTTTGCAC
>probe:Drosophila_2:1634321_s_at:508:693; Interrogation_Position=235; Antisense; TTTGCACATCTACTTGGGCGTCGAT
>probe:Drosophila_2:1634321_s_at:187:257; Interrogation_Position=253; Antisense; CGTCGATTACGGCAAACGGGTGAAT
>probe:Drosophila_2:1634321_s_at:13:105; Interrogation_Position=304; Antisense; AGACGACGTCGTCAGCACAATTGCT
>probe:Drosophila_2:1634321_s_at:569:247; Interrogation_Position=322; Antisense; AATTGCTCAGAGTCTACCGGACGGC
>probe:Drosophila_2:1634321_s_at:224:611; Interrogation_Position=394; Antisense; TGACAAATTTCAGCCCTTCGGTGAG
>probe:Drosophila_2:1634321_s_at:263:125; Interrogation_Position=459; Antisense; AGCGCCTTTTCGAGATCTACCAGTG
>probe:Drosophila_2:1634321_s_at:375:11; Interrogation_Position=502; Antisense; ATTCTTAAAGTTCTTTGCCCGGCTG
>probe:Drosophila_2:1634321_s_at:4:335; Interrogation_Position=523; Antisense; GCTGCAGACGTTCATCTTGTGGTTC
>probe:Drosophila_2:1634321_s_at:421:627; Interrogation_Position=556; Antisense; TGCCTCCTACATCGACACTGATGAT
>probe:Drosophila_2:1634321_s_at:659:447; Interrogation_Position=578; Antisense; GATCCACAGTGGTGTTACTTCTTGA

Paste this into a BLAST search page for me
ATCAACAATGATGCCCTGACCTTTCGACGATTTTCGGCTACCAGGACTTGCAGGACTTGCACGTCCGTGTAATGTAATGTACACGGCAGGACCTTTGCACTTTGCACATCTACTTGGGCGTCGATCGTCGATTACGGCAAACGGGTGAATAGACGACGTCGTCAGCACAATTGCTAATTGCTCAGAGTCTACCGGACGGCTGACAAATTTCAGCCCTTCGGTGAGAGCGCCTTTTCGAGATCTACCAGTGATTCTTAAAGTTCTTTGCCCGGCTGGCTGCAGACGTTCATCTTGTGGTTCTGCCTCCTACATCGACACTGATGATGATCCACAGTGGTGTTACTTCTTGA

Full Affymetrix probeset data:

Annotations for 1634321_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime