FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634323_at:

>probe:Drosophila_2:1634323_at:450:679; Interrogation_Position=1006; Antisense; TATGTGCCCGTAAACGGACAGGCCC
>probe:Drosophila_2:1634323_at:560:55; Interrogation_Position=524; Antisense; ATGAACACCATCATTTGTCCATGGA
>probe:Drosophila_2:1634323_at:136:237; Interrogation_Position=561; Antisense; AATCGGACACAGTTTGGGTGCCCAT
>probe:Drosophila_2:1634323_at:377:541; Interrogation_Position=624; Antisense; GGTTCACACGATTGTCGGTCTGGAT
>probe:Drosophila_2:1634323_at:395:49; Interrogation_Position=655; Antisense; ATGCCTCTTTTTGCCTACGATAAGC
>probe:Drosophila_2:1634323_at:521:669; Interrogation_Position=670; Antisense; TACGATAAGCCTGACAAGCGACTGT
>probe:Drosophila_2:1634323_at:604:205; Interrogation_Position=685; Antisense; AAGCGACTGTCCACCGAAGATGCCT
>probe:Drosophila_2:1634323_at:690:357; Interrogation_Position=767; Antisense; GCAAAGGCACTTTCTATCCGAATGG
>probe:Drosophila_2:1634323_at:417:33; Interrogation_Position=800; Antisense; ATCAACCAGGTTGCGGTTCAGACAT
>probe:Drosophila_2:1634323_at:704:705; Interrogation_Position=816; Antisense; TTCAGACATCGGAGGAACCTGCGCC
>probe:Drosophila_2:1634323_at:514:195; Interrogation_Position=855; Antisense; AACGTATTACGTGGAGGCAGTCACT
>probe:Drosophila_2:1634323_at:265:221; Interrogation_Position=901; Antisense; AAGTGTCACGACTACCAGGCTGCGT
>probe:Drosophila_2:1634323_at:21:291; Interrogation_Position=923; Antisense; CGTTGGCCAACGAGTGCGGAAGCAC
>probe:Drosophila_2:1634323_at:639:351; Interrogation_Position=944; Antisense; GCACCTACAGTGGAGTTCGCATGGG

Paste this into a BLAST search page for me
TATGTGCCCGTAAACGGACAGGCCCATGAACACCATCATTTGTCCATGGAAATCGGACACAGTTTGGGTGCCCATGGTTCACACGATTGTCGGTCTGGATATGCCTCTTTTTGCCTACGATAAGCTACGATAAGCCTGACAAGCGACTGTAAGCGACTGTCCACCGAAGATGCCTGCAAAGGCACTTTCTATCCGAATGGATCAACCAGGTTGCGGTTCAGACATTTCAGACATCGGAGGAACCTGCGCCAACGTATTACGTGGAGGCAGTCACTAAGTGTCACGACTACCAGGCTGCGTCGTTGGCCAACGAGTGCGGAAGCACGCACCTACAGTGGAGTTCGCATGGG

Full Affymetrix probeset data:

Annotations for 1634323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720