FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634324_at:

>probe:Drosophila_2:1634324_at:14:87; Interrogation_Position=107; Antisense; AGTGCCGTCTGTCAACCAAAATCTG
>probe:Drosophila_2:1634324_at:61:203; Interrogation_Position=120; Antisense; AACCAAAATCTGTGTCATTTGCGAT
>probe:Drosophila_2:1634324_at:411:61; Interrogation_Position=13; Antisense; ATGGAATCCCCGGACAACAGGCTGT
>probe:Drosophila_2:1634324_at:70:455; Interrogation_Position=142; Antisense; GATAAGAAGTTTGAGCCGCGCGAAA
>probe:Drosophila_2:1634324_at:294:231; Interrogation_Position=165; Antisense; AATGTCGCAAGTTTACTGCAAGCAA
>probe:Drosophila_2:1634324_at:358:111; Interrogation_Position=185; Antisense; AGCAATGCAATTTCTACATCGAGAG
>probe:Drosophila_2:1634324_at:620:425; Interrogation_Position=205; Antisense; GAGAGACATGCCGTAGTCAAGCCCC
>probe:Drosophila_2:1634324_at:129:129; Interrogation_Position=255; Antisense; ACCAGCGGAGATGACCAGTGGGCCA
>probe:Drosophila_2:1634324_at:440:189; Interrogation_Position=28; Antisense; AACAGGCTGTACATGTGCACCGCGT
>probe:Drosophila_2:1634324_at:722:543; Interrogation_Position=289; Antisense; GGATCTTCGATCACAGAGCGCTGGA
>probe:Drosophila_2:1634324_at:637:285; Interrogation_Position=309; Antisense; CTGGAAGGAGATTAAGGCCGCCGCT
>probe:Drosophila_2:1634324_at:90:301; Interrogation_Position=327; Antisense; CGCCGCTGGAATCGTGGATGACTTT
>probe:Drosophila_2:1634324_at:54:505; Interrogation_Position=42; Antisense; GTGCACCGCGTGCTTTAAAAGGTTT
>probe:Drosophila_2:1634324_at:81:73; Interrogation_Position=61; Antisense; AGGTTTCTTTGGAGCGAACTGTCGA

Paste this into a BLAST search page for me
AGTGCCGTCTGTCAACCAAAATCTGAACCAAAATCTGTGTCATTTGCGATATGGAATCCCCGGACAACAGGCTGTGATAAGAAGTTTGAGCCGCGCGAAAAATGTCGCAAGTTTACTGCAAGCAAAGCAATGCAATTTCTACATCGAGAGGAGAGACATGCCGTAGTCAAGCCCCACCAGCGGAGATGACCAGTGGGCCAAACAGGCTGTACATGTGCACCGCGTGGATCTTCGATCACAGAGCGCTGGACTGGAAGGAGATTAAGGCCGCCGCTCGCCGCTGGAATCGTGGATGACTTTGTGCACCGCGTGCTTTAAAAGGTTTAGGTTTCTTTGGAGCGAACTGTCGA

Full Affymetrix probeset data:

Annotations for 1634324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720