FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634329_at:

>probe:Drosophila_2:1634329_at:461:55; Interrogation_Position=1000; Antisense; ATGAACTATTCGTACTGCCTGTGCT
>probe:Drosophila_2:1634329_at:679:619; Interrogation_Position=1021; Antisense; TGCTTTGGCGTTGTCTATCTATTTA
>probe:Drosophila_2:1634329_at:29:687; Interrogation_Position=1078; Antisense; TATAAGTACGCCTTCTATCTCACAT
>probe:Drosophila_2:1634329_at:714:615; Interrogation_Position=1112; Antisense; TGCAAAATATCATCGCCTGCGCTTT
>probe:Drosophila_2:1634329_at:502:725; Interrogation_Position=1135; Antisense; TTGTACATTCCCTTGTATCTTGCCA
>probe:Drosophila_2:1634329_at:476:313; Interrogation_Position=1162; Antisense; GCCATCATTGCCTTGTATATTGTCG
>probe:Drosophila_2:1634329_at:382:29; Interrogation_Position=1201; Antisense; ATAATCTACTACACGTACTGCCATC
>probe:Drosophila_2:1634329_at:462:143; Interrogation_Position=1217; Antisense; ACTGCCATCCAAATACTGTGCGTAC
>probe:Drosophila_2:1634329_at:50:607; Interrogation_Position=728; Antisense; TGATCGTCTACTTCGGCAACATAGC
>probe:Drosophila_2:1634329_at:565:675; Interrogation_Position=749; Antisense; TAGCGTGGTGCATCCAGGCGTACAA
>probe:Drosophila_2:1634329_at:78:529; Interrogation_Position=822; Antisense; GGGACGATTTCTGCAATTTCTCTTC
>probe:Drosophila_2:1634329_at:498:277; Interrogation_Position=874; Antisense; CTTTGCATCGCGTATGTGGCCAGTA
>probe:Drosophila_2:1634329_at:261:521; Interrogation_Position=889; Antisense; GTGGCCAGTATTTTTCCCATCGAAA
>probe:Drosophila_2:1634329_at:145:275; Interrogation_Position=954; Antisense; CATTGTGTTCTTTGTGGACTCGCCA

Paste this into a BLAST search page for me
ATGAACTATTCGTACTGCCTGTGCTTGCTTTGGCGTTGTCTATCTATTTATATAAGTACGCCTTCTATCTCACATTGCAAAATATCATCGCCTGCGCTTTTTGTACATTCCCTTGTATCTTGCCAGCCATCATTGCCTTGTATATTGTCGATAATCTACTACACGTACTGCCATCACTGCCATCCAAATACTGTGCGTACTGATCGTCTACTTCGGCAACATAGCTAGCGTGGTGCATCCAGGCGTACAAGGGACGATTTCTGCAATTTCTCTTCCTTTGCATCGCGTATGTGGCCAGTAGTGGCCAGTATTTTTCCCATCGAAACATTGTGTTCTTTGTGGACTCGCCA

Full Affymetrix probeset data:

Annotations for 1634329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720