Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634330_at:

>probe:Drosophila_2:1634330_at:361:677; Interrogation_Position=7659; Antisense; TAGAGCACCCATTGCATCTGCAGAA
>probe:Drosophila_2:1634330_at:704:241; Interrogation_Position=7700; Antisense; AATAGTCAGCACACGCAACCGGAAA
>probe:Drosophila_2:1634330_at:589:673; Interrogation_Position=7725; Antisense; TAGCTCCACAATACGGTCAAGTTAT
>probe:Drosophila_2:1634330_at:584:385; Interrogation_Position=7751; Antisense; GAACAGACCTATGGCATCTGGCATA
>probe:Drosophila_2:1634330_at:159:509; Interrogation_Position=7901; Antisense; GTGCACACCTACGAGTTGGCGGATA
>probe:Drosophila_2:1634330_at:19:443; Interrogation_Position=7957; Antisense; GATGGGCAAGTATCGCGACTCAACA
>probe:Drosophila_2:1634330_at:359:655; Interrogation_Position=7989; Antisense; TAATCATCAGCAAATTCTCGCCTCT
>probe:Drosophila_2:1634330_at:466:11; Interrogation_Position=8002; Antisense; ATTCTCGCCTCTTCAACTGAATGAG
>probe:Drosophila_2:1634330_at:445:369; Interrogation_Position=8020; Antisense; GAATGAGCGCCTTACATTGTTCCTC
>probe:Drosophila_2:1634330_at:280:667; Interrogation_Position=8032; Antisense; TACATTGTTCCTCAAGTCCAGCAGA
>probe:Drosophila_2:1634330_at:53:115; Interrogation_Position=8051; Antisense; AGCAGACCAATTGCCGAGCTGGTTA
>probe:Drosophila_2:1634330_at:611:563; Interrogation_Position=8079; Antisense; GGAATGCCACCGATTCCAGCATGTG
>probe:Drosophila_2:1634330_at:186:215; Interrogation_Position=8162; Antisense; AAGAGGTTCTTTCGTACTCTCGTGA
>probe:Drosophila_2:1634330_at:499:641; Interrogation_Position=8179; Antisense; TCTCGTGATAGTCCTTTTGTGCGTT

Paste this into a BLAST search page for me
TAGAGCACCCATTGCATCTGCAGAAAATAGTCAGCACACGCAACCGGAAATAGCTCCACAATACGGTCAAGTTATGAACAGACCTATGGCATCTGGCATAGTGCACACCTACGAGTTGGCGGATAGATGGGCAAGTATCGCGACTCAACATAATCATCAGCAAATTCTCGCCTCTATTCTCGCCTCTTCAACTGAATGAGGAATGAGCGCCTTACATTGTTCCTCTACATTGTTCCTCAAGTCCAGCAGAAGCAGACCAATTGCCGAGCTGGTTAGGAATGCCACCGATTCCAGCATGTGAAGAGGTTCTTTCGTACTCTCGTGATCTCGTGATAGTCCTTTTGTGCGTT

Full Affymetrix probeset data:

Annotations for 1634330_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime