FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634331_at:

>probe:Drosophila_2:1634331_at:113:35; Interrogation_Position=2525; Antisense; ATCACACAGAGGCTTTGCGTGCGCT
>probe:Drosophila_2:1634331_at:151:447; Interrogation_Position=2605; Antisense; GATGCGGCCAAACTGGATCCGAGCT
>probe:Drosophila_2:1634331_at:134:547; Interrogation_Position=2619; Antisense; GGATCCGAGCTGTCCAAAAATTTGG
>probe:Drosophila_2:1634331_at:418:427; Interrogation_Position=2665; Antisense; GAGATCCTGGGCGATTTCCATGCCT
>probe:Drosophila_2:1634331_at:522:19; Interrogation_Position=2678; Antisense; ATTTCCATGCCTCAGCCGATTGCTT
>probe:Drosophila_2:1634331_at:226:139; Interrogation_Position=2707; Antisense; ACGTCGCTGCAGTTAGAGCCATCAT
>probe:Drosophila_2:1634331_at:567:475; Interrogation_Position=2718; Antisense; GTTAGAGCCATCATGTCCGGTGCTA
>probe:Drosophila_2:1634331_at:379:509; Interrogation_Position=2737; Antisense; GTGCTACCTTTTACTTCTATACCTT
>probe:Drosophila_2:1634331_at:600:557; Interrogation_Position=2775; Antisense; GGAACACTTTCGTGTCTAATTCGAA
>probe:Drosophila_2:1634331_at:558:29; Interrogation_Position=2838; Antisense; ATACTTCCTAATTCCTTCAGTGTAA
>probe:Drosophila_2:1634331_at:104:3; Interrogation_Position=2865; Antisense; ATTGTTGTATCGCAGTTTTGGAGCA
>probe:Drosophila_2:1634331_at:340:637; Interrogation_Position=2937; Antisense; TCGAGCTTGGCTGTATTATGTGAAT
>probe:Drosophila_2:1634331_at:155:367; Interrogation_Position=2958; Antisense; GAATGAACCATTCTGCTATCTTCCT
>probe:Drosophila_2:1634331_at:311:677; Interrogation_Position=2974; Antisense; TATCTTCCTTAATCACCCACTTTTA

Paste this into a BLAST search page for me
ATCACACAGAGGCTTTGCGTGCGCTGATGCGGCCAAACTGGATCCGAGCTGGATCCGAGCTGTCCAAAAATTTGGGAGATCCTGGGCGATTTCCATGCCTATTTCCATGCCTCAGCCGATTGCTTACGTCGCTGCAGTTAGAGCCATCATGTTAGAGCCATCATGTCCGGTGCTAGTGCTACCTTTTACTTCTATACCTTGGAACACTTTCGTGTCTAATTCGAAATACTTCCTAATTCCTTCAGTGTAAATTGTTGTATCGCAGTTTTGGAGCATCGAGCTTGGCTGTATTATGTGAATGAATGAACCATTCTGCTATCTTCCTTATCTTCCTTAATCACCCACTTTTA

Full Affymetrix probeset data:

Annotations for 1634331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720