Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634334_at:

>probe:Drosophila_2:1634334_at:647:363; Interrogation_Position=1553; Antisense; GAATACGACCGGCACTTGGGATCTG
>probe:Drosophila_2:1634334_at:582:729; Interrogation_Position=1568; Antisense; TTGGGATCTGTGAGCACCATCACCT
>probe:Drosophila_2:1634334_at:591:33; Interrogation_Position=1586; Antisense; ATCACCTTTGTGGACGACAACCGAC
>probe:Drosophila_2:1634334_at:226:397; Interrogation_Position=1601; Antisense; GACAACCGACGGTTTGTGACCACCT
>probe:Drosophila_2:1634334_at:105:611; Interrogation_Position=1617; Antisense; TGACCACCTCGGACGACAAATCGAT
>probe:Drosophila_2:1634334_at:62:85; Interrogation_Position=1653; Antisense; AGTGGGACATTCCTGTGGACATGAA
>probe:Drosophila_2:1634334_at:61:559; Interrogation_Position=1669; Antisense; GGACATGAAGTACATTGCCGACCCC
>probe:Drosophila_2:1634334_at:33:683; Interrogation_Position=1696; Antisense; TATGCATTCCATGCCGGCGGTCACA
>probe:Drosophila_2:1634334_at:676:547; Interrogation_Position=1740; Antisense; GGATGGCCTGCCAGTCGTTAGACAA
>probe:Drosophila_2:1634334_at:218:321; Interrogation_Position=1784; Antisense; GCCCTCAATCGCTTCAAGATGAACC
>probe:Drosophila_2:1634334_at:587:183; Interrogation_Position=1812; Antisense; AAAAGACCTTCACCGGTCACATGGT
>probe:Drosophila_2:1634334_at:438:119; Interrogation_Position=1854; Antisense; AGCTGGACTTTTCGCCGGACATGAG
>probe:Drosophila_2:1634334_at:398:153; Interrogation_Position=1872; Antisense; ACATGAGCTATCTGGTGTCGGGCGA
>probe:Drosophila_2:1634334_at:92:607; Interrogation_Position=1999; Antisense; TGAGGCCAGCAAAGTGGTCACCGCT

Paste this into a BLAST search page for me
GAATACGACCGGCACTTGGGATCTGTTGGGATCTGTGAGCACCATCACCTATCACCTTTGTGGACGACAACCGACGACAACCGACGGTTTGTGACCACCTTGACCACCTCGGACGACAAATCGATAGTGGGACATTCCTGTGGACATGAAGGACATGAAGTACATTGCCGACCCCTATGCATTCCATGCCGGCGGTCACAGGATGGCCTGCCAGTCGTTAGACAAGCCCTCAATCGCTTCAAGATGAACCAAAAGACCTTCACCGGTCACATGGTAGCTGGACTTTTCGCCGGACATGAGACATGAGCTATCTGGTGTCGGGCGATGAGGCCAGCAAAGTGGTCACCGCT

Full Affymetrix probeset data:

Annotations for 1634334_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime