FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634335_at:

>probe:Drosophila_2:1634335_at:479:419; Interrogation_Position=100; Antisense; GAGCAGGCCAAGAGCTATAAGCCAA
>probe:Drosophila_2:1634335_at:648:201; Interrogation_Position=118; Antisense; AAGCCAAGCAACAAGCCACGTTTCT
>probe:Drosophila_2:1634335_at:358:55; Interrogation_Position=13; Antisense; ATGAAGCCCATGACGCTACTAAAAG
>probe:Drosophila_2:1634335_at:379:213; Interrogation_Position=161; Antisense; AAGAGGTGGCCACTGTGTGCCTTTT
>probe:Drosophila_2:1634335_at:636:627; Interrogation_Position=178; Antisense; TGCCTTTTGGTGGTCATTTTGTTGA
>probe:Drosophila_2:1634335_at:562:15; Interrogation_Position=193; Antisense; ATTTTGTTGATGCTCTTGTTTGGAC
>probe:Drosophila_2:1634335_at:161:681; Interrogation_Position=208; Antisense; TTGTTTGGACTTTACCTGGCCAGGA
>probe:Drosophila_2:1634335_at:555:561; Interrogation_Position=230; Antisense; GGAACTACAATCACGCCTATATCTA
>probe:Drosophila_2:1634335_at:12:317; Interrogation_Position=244; Antisense; GCCTATATCTATGGCTCTGGTGGAT
>probe:Drosophila_2:1634335_at:372:287; Interrogation_Position=260; Antisense; CTGGTGGATGCCTTTCGACGTTTTT
>probe:Drosophila_2:1634335_at:689:595; Interrogation_Position=284; Antisense; TGTGGACATACGATGAATGCCAAAT
>probe:Drosophila_2:1634335_at:263:613; Interrogation_Position=45; Antisense; TGAAGAATGCGACAGCCCCGATGAG
>probe:Drosophila_2:1634335_at:290:57; Interrogation_Position=65; Antisense; ATGAGGCGACGGCAACAGTGCATCA
>probe:Drosophila_2:1634335_at:283:155; Interrogation_Position=79; Antisense; ACAGTGCATCAGAGGGCCCAGGAGC

Paste this into a BLAST search page for me
GAGCAGGCCAAGAGCTATAAGCCAAAAGCCAAGCAACAAGCCACGTTTCTATGAAGCCCATGACGCTACTAAAAGAAGAGGTGGCCACTGTGTGCCTTTTTGCCTTTTGGTGGTCATTTTGTTGAATTTTGTTGATGCTCTTGTTTGGACTTGTTTGGACTTTACCTGGCCAGGAGGAACTACAATCACGCCTATATCTAGCCTATATCTATGGCTCTGGTGGATCTGGTGGATGCCTTTCGACGTTTTTTGTGGACATACGATGAATGCCAAATTGAAGAATGCGACAGCCCCGATGAGATGAGGCGACGGCAACAGTGCATCAACAGTGCATCAGAGGGCCCAGGAGC

Full Affymetrix probeset data:

Annotations for 1634335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720