Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634336_at:

>probe:Drosophila_2:1634336_at:314:609; Interrogation_Position=1421; Antisense; TGAGCATGGAGCAGCCGTCAGCGTC
>probe:Drosophila_2:1634336_at:697:411; Interrogation_Position=1464; Antisense; GACCGAGGAAGTGCCATCATCGCCA
>probe:Drosophila_2:1634336_at:573:139; Interrogation_Position=1503; Antisense; ACGTGTACCTCGCTTCAGAAGCTAA
>probe:Drosophila_2:1634336_at:656:339; Interrogation_Position=1523; Antisense; GCTAAACTAATGCTGTGCACATCGA
>probe:Drosophila_2:1634336_at:458:179; Interrogation_Position=1576; Antisense; AAAAAAGCTACTCTTCTCATGGGAA
>probe:Drosophila_2:1634336_at:608:19; Interrogation_Position=1643; Antisense; ATTTGTCCAATAGTGCGGACTCCAT
>probe:Drosophila_2:1634336_at:137:87; Interrogation_Position=1654; Antisense; AGTGCGGACTCCATATTTGTATTCG
>probe:Drosophila_2:1634336_at:263:459; Interrogation_Position=1747; Antisense; GATTTATTACCCCTGTTTTGAGATT
>probe:Drosophila_2:1634336_at:93:143; Interrogation_Position=1795; Antisense; ACTGTGTTTACATTTATTTGGCAAA
>probe:Drosophila_2:1634336_at:659:663; Interrogation_Position=1822; Antisense; TACAAATGTGTTTGCTTTTCACTTT
>probe:Drosophila_2:1634336_at:396:659; Interrogation_Position=1879; Antisense; TAAGAAATCCTTTAGTGCCTGAATT
>probe:Drosophila_2:1634336_at:620:307; Interrogation_Position=1895; Antisense; GCCTGAATTTATTTTGCAACTACGT
>probe:Drosophila_2:1634336_at:703:481; Interrogation_Position=1927; Antisense; GTATGAGGAACTTACCAGTTTTTCT
>probe:Drosophila_2:1634336_at:274:129; Interrogation_Position=1940; Antisense; ACCAGTTTTTCTTATTTGCTTTGCA

Paste this into a BLAST search page for me
TGAGCATGGAGCAGCCGTCAGCGTCGACCGAGGAAGTGCCATCATCGCCAACGTGTACCTCGCTTCAGAAGCTAAGCTAAACTAATGCTGTGCACATCGAAAAAAAGCTACTCTTCTCATGGGAAATTTGTCCAATAGTGCGGACTCCATAGTGCGGACTCCATATTTGTATTCGGATTTATTACCCCTGTTTTGAGATTACTGTGTTTACATTTATTTGGCAAATACAAATGTGTTTGCTTTTCACTTTTAAGAAATCCTTTAGTGCCTGAATTGCCTGAATTTATTTTGCAACTACGTGTATGAGGAACTTACCAGTTTTTCTACCAGTTTTTCTTATTTGCTTTGCA

Full Affymetrix probeset data:

Annotations for 1634336_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime