FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634339_at:

>probe:Drosophila_2:1634339_at:675:151; Interrogation_Position=500; Antisense; ACATCACCAAGCAAATCGACGAGCA
>probe:Drosophila_2:1634339_at:242:237; Interrogation_Position=513; Antisense; AATCGACGAGCAGGCGAACCGCATT
>probe:Drosophila_2:1634339_at:83:381; Interrogation_Position=528; Antisense; GAACCGCATTATCTCGAAGCTGCTG
>probe:Drosophila_2:1634339_at:52:119; Interrogation_Position=545; Antisense; AGCTGCTGAGAACTTTGGGACCCAC
>probe:Drosophila_2:1634339_at:468:679; Interrogation_Position=559; Antisense; TTGGGACCCACGGTTCTGCGTACCG
>probe:Drosophila_2:1634339_at:618:615; Interrogation_Position=575; Antisense; TGCGTACCGCCATCCAGGGAAATAC
>probe:Drosophila_2:1634339_at:197:617; Interrogation_Position=600; Antisense; TGCAAATGCGGCCAGGACCAGTTTC
>probe:Drosophila_2:1634339_at:113:269; Interrogation_Position=612; Antisense; CAGGACCAGTTTCGATGCGGACTTC
>probe:Drosophila_2:1634339_at:324:447; Interrogation_Position=625; Antisense; GATGCGGACTTCGATGATGATGACG
>probe:Drosophila_2:1634339_at:542:151; Interrogation_Position=688; Antisense; ACATCCGGTGGTGATAGTGGCACCC
>probe:Drosophila_2:1634339_at:725:677; Interrogation_Position=702; Antisense; TAGTGGCACCCGTGTGACCATCGAA
>probe:Drosophila_2:1634339_at:41:35; Interrogation_Position=733; Antisense; ACCTTCGAACCCGATGATGACAACG
>probe:Drosophila_2:1634339_at:548:445; Interrogation_Position=748; Antisense; GATGACAACGAGATCGATGCGGAAA
>probe:Drosophila_2:1634339_at:336:425; Interrogation_Position=781; Antisense; GAGAGCAGCTCCACCAGTACCACAA

Paste this into a BLAST search page for me
ACATCACCAAGCAAATCGACGAGCAAATCGACGAGCAGGCGAACCGCATTGAACCGCATTATCTCGAAGCTGCTGAGCTGCTGAGAACTTTGGGACCCACTTGGGACCCACGGTTCTGCGTACCGTGCGTACCGCCATCCAGGGAAATACTGCAAATGCGGCCAGGACCAGTTTCCAGGACCAGTTTCGATGCGGACTTCGATGCGGACTTCGATGATGATGACGACATCCGGTGGTGATAGTGGCACCCTAGTGGCACCCGTGTGACCATCGAAACCTTCGAACCCGATGATGACAACGGATGACAACGAGATCGATGCGGAAAGAGAGCAGCTCCACCAGTACCACAA

Full Affymetrix probeset data:

Annotations for 1634339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720