FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634340_at:

>probe:Drosophila_2:1634340_at:158:533; Interrogation_Position=4809; Antisense; GGTGGCCAACAAGCAAATCACTAGT
>probe:Drosophila_2:1634340_at:517:115; Interrogation_Position=4846; Antisense; AGCGTTGTAAACAGCTCCACGACAG
>probe:Drosophila_2:1634340_at:50:675; Interrogation_Position=4902; Antisense; TAGCAACAATCTCGTTTTCGCCGTG
>probe:Drosophila_2:1634340_at:76:225; Interrogation_Position=4928; Antisense; AAGGCAACGGCGGACAGCTCTTCTT
>probe:Drosophila_2:1634340_at:355:713; Interrogation_Position=4951; Antisense; TTCTCACCGGGACTGCAGGGCATGA
>probe:Drosophila_2:1634340_at:656:347; Interrogation_Position=4970; Antisense; GCATGAACCTAAAGCCACTGTCCAG
>probe:Drosophila_2:1634340_at:415:171; Interrogation_Position=4999; Antisense; AAAGTGATACCCATGGCTGCAGCAT
>probe:Drosophila_2:1634340_at:675:73; Interrogation_Position=5046; Antisense; AGGAAAAATCTCTGTGACCACGGCA
>probe:Drosophila_2:1634340_at:469:289; Interrogation_Position=5066; Antisense; CGGCAGCCGGCGAAACAGGAGCAAA
>probe:Drosophila_2:1634340_at:636:331; Interrogation_Position=5094; Antisense; GCTGACTACAAAACTAATACCGGCT
>probe:Drosophila_2:1634340_at:694:663; Interrogation_Position=5118; Antisense; TACGGTTCTCAAGACGGCCACAGGG
>probe:Drosophila_2:1634340_at:67:121; Interrogation_Position=5165; Antisense; AGCGGAGAGGCTTGGTAACCACGTT
>probe:Drosophila_2:1634340_at:622:659; Interrogation_Position=5180; Antisense; TAACCACGTTGAATATCCTTACCGG
>probe:Drosophila_2:1634340_at:623:597; Interrogation_Position=5313; Antisense; TGTCCCATCCAGCAACCAATTTTAT

Paste this into a BLAST search page for me
GGTGGCCAACAAGCAAATCACTAGTAGCGTTGTAAACAGCTCCACGACAGTAGCAACAATCTCGTTTTCGCCGTGAAGGCAACGGCGGACAGCTCTTCTTTTCTCACCGGGACTGCAGGGCATGAGCATGAACCTAAAGCCACTGTCCAGAAAGTGATACCCATGGCTGCAGCATAGGAAAAATCTCTGTGACCACGGCACGGCAGCCGGCGAAACAGGAGCAAAGCTGACTACAAAACTAATACCGGCTTACGGTTCTCAAGACGGCCACAGGGAGCGGAGAGGCTTGGTAACCACGTTTAACCACGTTGAATATCCTTACCGGTGTCCCATCCAGCAACCAATTTTAT

Full Affymetrix probeset data:

Annotations for 1634340_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720